genetically encoded förster resonance energy transfer (fret)-based atp biosensor Search Results


90
ATeam Scientific fret-based nanosensor ateam1.03yemk
Fret Based Nanosensor Ateam1.03yemk, supplied by ATeam Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/ateam1+03+nd+na/pm31549401-30-5-12
Average 90 stars, based on 1 article reviews
fret-based nanosensor ateam1.03yemk - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc fret based lactate sensor13
Fret Based Lactate Sensor13, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/Laconic%2FpcDNA3%2E1(-)+(Plasmid+%2344238)/pm37777962-219-10-13
Average 93 stars, based on 1 article reviews
fret based lactate sensor13 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Technik GmbH automated calf feeding system förster-technik
Automated Calf Feeding System Förster Technik, supplied by Technik GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/electronic+feeding+system+vario/pm30007809-61-10-13
Average 90 stars, based on 1 article reviews
automated calf feeding system förster-technik - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
Bethyl pqbp1
(A) Single Z image of PMA-differentiated THP-1 cells (PMA-THP-1) infected with HIV- 1 virions labeled with Gag-IN-mRuby3 (red). The viral fusion was synchronized and one-hour post-infection, immunostaining of <t>PQBP1</t> protein (green) was performed. Zoomed images of individual viral particles associating with PQBP1 are shown on the right. (B) Left, distribution of IN-to-PQBP1 nearest neighbor distances (Count). The distribution of experimental data (blue histogram) is compared with the one generated from in silico randomized dots (magenta histogram). A kernel density estimate of each distribution is overplotted as a solid curve, represented as Frequency, N=32,033 INs. Right, the cumulative probability of nearest neighbor distance ( d ) measures the percentage of IN dots that have PQBP1 within a defined d . For example, the percentage of INs that have PQBP1 at d < 0.4 µm is a 43% of for experimental data and 9% for randomized dots as highlighted by grey dotted lines. (C) CA tube co-pelleting assay. Insoluble cross-linked CA A14C/E45C tubes were incubated together with PQBP1 or maltose binding protein (MBP; Input) and separated into supernatant and pellet fractions (Sup and Pellet, respectively) then analyzed via reducing SDS-PAGE. The data are representative of at least three independent experiments.
Pqbp1, supplied by Bethyl, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/PQBP1+Antibody/bio_rxiv__2022__01__10__472699-160-9-10
Average 92 stars, based on 1 article reviews
pqbp1 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

94
Selleck Chemicals dynasore
(A) IL-1β release of LPS-primed wt Balb/c iBMDMs treated <t>with</t> <t>Dyngo-4a,</t> <t>Dynasore</t> (40/ 80/ 160 µM), ATP (2 mM) or Nigericin (2 µM) for 90 min; n = 3. (B) IL-1β release of LPS-primed C57Bl6 BMDMs stimulated with Nigericin (2 µM), Dyngo-4a (80 µM) or Dynasore (160 µM) in presence of excessive KCl (0-80 mM) or the Caspase-1 inhibitor VX-765 (10 µM); n = 3 (C) Quantification of intracellular K + via ion-selective electrode measurement. MCC-950 indicates Nlrp3 inhibitor treatment. (D) Representative Western blot for cleaved (p20) and uncleaved (p45) caspase-1 from primary C57Bl6 BMDM supernatants; n = 3 (E) As in C, but in presence of increasing concentrations of KCl; n = 3. (F) Representative Western blot for mature and pro-IL-1β in presence or absence of excess 80 mM KCl in wt Balb/C iBMDMs, NLRP3- or Caspase-1/11 deficient iBMDMs, treated with 80 µM Dynasore, 10 µM Nigericin, 60 µg/ml R837 (left) or 20/ 40/ 80 µM Dynasore or Dyngo-4a (right); n = 2. (G) Relative AlexaFlour-647 labelled transferrin (Tfn, left) or AlexaFlour-594 labelled Choleratoxin-B (CtxB, right) uptake in ASC -/- iBMDMs in the presence of Dyngo-4a or Dynasore; n = 3 (H) Enrichment analysis for GOCC terms and Uniprot keywords using Fisher exact test on proteins significantly (p < 0.05; FDR < 0.02) changing localization in ASC -/- iBMDMs in presence of Dyngo-4a (80 µM), Dynasore (160 µM) or Nigericin (2 µM) relative to LPS-primed control. (I) Profile plots showing relative AP2-complex subunit (AP2a1, AP2a2, AP2b1, AP2m1, AP2s1) distribution across fractions. (J) 3D-Principal-component-analysis showing transition of AP2-complex subunits (grey-LPS, black-Nigericin, movement indicated by lines) upon 80 µM Dyngo-4a (left) or 160 µM Dynasore (right) treatment with annotations for endosomal (red), Golgi- (orange) or plasma membrane proteins (violet). (K) Representative confocal microscopy images of LPS-primed ASC -/- iBMDMs stably expressing functional AP2a1-eGFP-AP2b1 fusion protein and transiently expressing NLRP3-tagRFP, co-stained with DAPI. Statistics indicate significance by student’s two-tailed t-test (A, B, C, F, G).
Dynasore, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/Dynasore/bio_rxiv__64898__2026__02__24__707400-178-87-89
Average 94 stars, based on 1 article reviews
dynasore - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
R&D Systems Hematology hepo elisa assay
a Design of biodegradable alkyne lipids and layout of the combination strategy. b Cryo-EM image and schematic illustration of mRNA loaded LNPs. c – e I.v. injection of <t>hEPO</t> mRNA loaded LNPs containing two different ionizable lipids (0.75 mg/kg of hEPO mRNA). c cKK-E12 and alkyne lipid combinations were evaluated at two molar ratios (left: 5:5, right: 7:3); combination of C12-200 and MC3 with alkyne lipids were evaluated at molar ratio 7:3, respectively. Formulation includes a composition of ionizable lipid:DOPE:cholesterol:C14-PEG2000 at the molar ratio of 35:16.0:46.5:2.5. Six hours after injection, hEPO protein in the serum was detected and quantified using hEPO <t>ELISA.</t> Red stars highlight the top-performing synergistic LNPs ( n = 4/group). f , g IVIS images and quantification of luciferase expression. mRNA encoding firefly luciferase mRNA (Fluc mRNA) was formulated with LNPs composed of various molar ratios of cKK-E12 and A6. A molar ratio of cKK-E12:A6 at 7:3 (Syn-3) demonstrated the most robust enhancement in Fluc protein expression in the liver ( n = 4 in cKK-E12, 9:1, 8:2, 6:4, n = 5 in 7:3 group, n = 3 in 4:6 and A6 groups, representative images were shown in f ). h The optimal ratio of cKK-E12:A6 in the LNP formulation was also evaluated using hEPO mRNA. The optimal ratio was also found to be 7:3. i , j Dose-dependent and time-dependent protein expression using Syn-3 (cKK-E12:A6 is 7:3) LNPs was compared with cKK-E12 LNPs, and demonstrated superior gene expression in vivo. Data are presented as mean ± SD. *** P < 0.001, **** P < 0.0001, Student’s T-test comparing to cKK-E12 group.
Hepo Elisa Assay, supplied by R&D Systems Hematology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/Human+Erythropoietin+R+DuoSet+ELISA/pmc07229004-349-30-33
Average 94 stars, based on 1 article reviews
hepo elisa assay - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
ATCC controls escherichia coli k12 pseudomonas aeruginoa
Figure 6 Effect of temperature on the degree of fusion between fluid liposomes and two gram-negative strains, <t>Escherichia</t> coli <t>K12</t> and <t>Pseudomonas</t> aeruginosa ATCC 25619, after 30 minutes at 37°C. Notes: One point nine milliliters of bacteria grown to an OD660 nm of 0.6 in Mueller Hinton broth was then mixed with labeled liposomes to a final concentration of 10 Å µg/mL and supplemented with 5 mM calcium. Fusion was monitored by rhodamine fluorescence decrease at 590 nm after 30 minutes resulting from resonance energy transfer efficiency decrease at three different temperatures. Data are shown as mean ± standard deviation (n=3). *Significance achieved for P,0.05. ATCC® 25619™ (American Type Culture Collection, Rockville, MD, USA). Abbreviation: OD, optical density.
Controls Escherichia Coli K12 Pseudomonas Aeruginoa, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/pRK5-based+plasmid+DNA48606-1479/10__2147_slash_ijn__s55807-191-37-106
Average 94 stars, based on 1 article reviews
controls escherichia coli k12 pseudomonas aeruginoa - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

99
Beyotime förster resonance energy transfer fret based dye pair
Figure 6 Effect of temperature on the degree of fusion between fluid liposomes and two gram-negative strains, <t>Escherichia</t> coli <t>K12</t> and <t>Pseudomonas</t> aeruginosa ATCC 25619, after 30 minutes at 37°C. Notes: One point nine milliliters of bacteria grown to an OD660 nm of 0.6 in Mueller Hinton broth was then mixed with labeled liposomes to a final concentration of 10 Å µg/mL and supplemented with 5 mM calcium. Fusion was monitored by rhodamine fluorescence decrease at 590 nm after 30 minutes resulting from resonance energy transfer efficiency decrease at three different temperatures. Data are shown as mean ± standard deviation (n=3). *Significance achieved for P,0.05. ATCC® 25619™ (American Type Culture Collection, Rockville, MD, USA). Abbreviation: OD, optical density.
Förster Resonance Energy Transfer Fret Based Dye Pair, supplied by Beyotime, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/DiO/pmc12737165-59-5-15
Average 99 stars, based on 1 article reviews
förster resonance energy transfer fret based dye pair - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology egfr phosphorylation levels
(A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, <t>EGFR,</t> ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after <t>anti-EGFR</t> antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.
Egfr Phosphorylation Levels, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/EGFR/pmc06307816-226-24-37
Average 96 stars, based on 1 article reviews
egfr phosphorylation levels - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
Danaher Inc anti phosphorylated egfr antibody
(A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, <t>EGFR,</t> ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.
Anti Phosphorylated Egfr Antibody, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/Anti-EGFR+(phospho+Y1068)+antibody/pmc06307816-157-114-122
Average 99 stars, based on 1 article reviews
anti phosphorylated egfr antibody - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

93
Addgene inc förster resonance energy transfer fret based akt activity reporter lyn aktar2 ev
(A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, <t>EGFR,</t> ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.
Förster Resonance Energy Transfer Fret Based Akt Activity Reporter Lyn Aktar2 Ev, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/pSBbi-Pur-Lyn-AktAR2-EV+(Plasmid+%23125199)/bio_rxiv__2025__10__25__684506-87-7-16
Average 93 stars, based on 1 article reviews
förster resonance energy transfer fret based akt activity reporter lyn aktar2 ev - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
ATeam Scientific fret-based indicator ateam
(A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, <t>EGFR,</t> ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.
Fret Based Indicator Ateam, supplied by ATeam Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genetically+encoded+f%C3%B6rster+resonance+energy+transfer+(fret)-based+atp+biosensor/ateam+expressing+k562+cells/bio_rxiv__2021__12__24__474151-101-11-17
Average 90 stars, based on 1 article reviews
fret-based indicator ateam - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


(A) Single Z image of PMA-differentiated THP-1 cells (PMA-THP-1) infected with HIV- 1 virions labeled with Gag-IN-mRuby3 (red). The viral fusion was synchronized and one-hour post-infection, immunostaining of PQBP1 protein (green) was performed. Zoomed images of individual viral particles associating with PQBP1 are shown on the right. (B) Left, distribution of IN-to-PQBP1 nearest neighbor distances (Count). The distribution of experimental data (blue histogram) is compared with the one generated from in silico randomized dots (magenta histogram). A kernel density estimate of each distribution is overplotted as a solid curve, represented as Frequency, N=32,033 INs. Right, the cumulative probability of nearest neighbor distance ( d ) measures the percentage of IN dots that have PQBP1 within a defined d . For example, the percentage of INs that have PQBP1 at d < 0.4 µm is a 43% of for experimental data and 9% for randomized dots as highlighted by grey dotted lines. (C) CA tube co-pelleting assay. Insoluble cross-linked CA A14C/E45C tubes were incubated together with PQBP1 or maltose binding protein (MBP; Input) and separated into supernatant and pellet fractions (Sup and Pellet, respectively) then analyzed via reducing SDS-PAGE. The data are representative of at least three independent experiments.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: (A) Single Z image of PMA-differentiated THP-1 cells (PMA-THP-1) infected with HIV- 1 virions labeled with Gag-IN-mRuby3 (red). The viral fusion was synchronized and one-hour post-infection, immunostaining of PQBP1 protein (green) was performed. Zoomed images of individual viral particles associating with PQBP1 are shown on the right. (B) Left, distribution of IN-to-PQBP1 nearest neighbor distances (Count). The distribution of experimental data (blue histogram) is compared with the one generated from in silico randomized dots (magenta histogram). A kernel density estimate of each distribution is overplotted as a solid curve, represented as Frequency, N=32,033 INs. Right, the cumulative probability of nearest neighbor distance ( d ) measures the percentage of IN dots that have PQBP1 within a defined d . For example, the percentage of INs that have PQBP1 at d < 0.4 µm is a 43% of for experimental data and 9% for randomized dots as highlighted by grey dotted lines. (C) CA tube co-pelleting assay. Insoluble cross-linked CA A14C/E45C tubes were incubated together with PQBP1 or maltose binding protein (MBP; Input) and separated into supernatant and pellet fractions (Sup and Pellet, respectively) then analyzed via reducing SDS-PAGE. The data are representative of at least three independent experiments.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Infection, Labeling, Immunostaining, Generated, In Silico, Incubation, Binding Assay, SDS Page

(A) Specificity of PQBP1 antibody (Sigma) and lack of effect on overall cGAS expression was confirmed by IF and/or western blot of THP-1 cells expressing indicated shRNAs (top) or MDDCs treated with indicated siRNAs (bottom). (B) Identification of viral particles from infected THP-1 cells was done with python with skimage, scipy, pims, and trackpy tools. In short, cells were subjected to a binary threshold so that no extracellular signals (viruses or cell debris) would confound the analysis. Viral particles were detected using thresholding and watershed segmentation methods or by using trackpy. The masks of the pixels that are positive for viral particles are then quantified for each independent channel (PQBP1, cGAS, iGFP, IN label, etc) and (C) for each field of view that was imaged, fraction of total virions (IN) showing positive PQBP1 signal (compared to secondary antibodies-only controls) were graphed. (D) Quantification of PQBP1 and IN distance distribution analysis. Left, probability distribution of distances, P(d) , from each virion (IN) to the nearest PQBP1 (blue). P(d) for uniformly distributed jitter J=1 µm (yellow) becomes similar to the distribution obtained by random shuffling of puncta (purple). Arrows indicate reasonable arbitrary thresholds δ to be applied to d values in determining association of PQBP1 puncta with corresponding IN. Data were obtained from 24 independent images (N=24,471). Right, the percentage of IN spots that have a PQBP1 within a chosen threshold, δ (0.1 µm < δ < 0.75 µm). See Supplemental Text for detail.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: (A) Specificity of PQBP1 antibody (Sigma) and lack of effect on overall cGAS expression was confirmed by IF and/or western blot of THP-1 cells expressing indicated shRNAs (top) or MDDCs treated with indicated siRNAs (bottom). (B) Identification of viral particles from infected THP-1 cells was done with python with skimage, scipy, pims, and trackpy tools. In short, cells were subjected to a binary threshold so that no extracellular signals (viruses or cell debris) would confound the analysis. Viral particles were detected using thresholding and watershed segmentation methods or by using trackpy. The masks of the pixels that are positive for viral particles are then quantified for each independent channel (PQBP1, cGAS, iGFP, IN label, etc) and (C) for each field of view that was imaged, fraction of total virions (IN) showing positive PQBP1 signal (compared to secondary antibodies-only controls) were graphed. (D) Quantification of PQBP1 and IN distance distribution analysis. Left, probability distribution of distances, P(d) , from each virion (IN) to the nearest PQBP1 (blue). P(d) for uniformly distributed jitter J=1 µm (yellow) becomes similar to the distribution obtained by random shuffling of puncta (purple). Arrows indicate reasonable arbitrary thresholds δ to be applied to d values in determining association of PQBP1 puncta with corresponding IN. Data were obtained from 24 independent images (N=24,471). Right, the percentage of IN spots that have a PQBP1 within a chosen threshold, δ (0.1 µm < δ < 0.75 µm). See Supplemental Text for detail.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Expressing, Western Blot, Infection

(A) Representative TCCD traces of AF488-PQBP1 (green) and AF568-labeled CA A204C particles (orange). The insets show schematics of the species detected by TCCD with PQBP1 and CA A204C particles represented as green stars and orange cones, respectively. Top, featureless PQBP1 trace due to the diffusion of PQBP1 monomers; middle, coincident peaks in both traces due to co-diffusion of multiple PQBP1 molecules bound to CA particles; bottom, featureless PQBP1 trace due to non-associated diffusion of PQBP1 monomers and CA particles in the presence of HCB. (B) PQBP1 binds to the R18 pore of capsid. TCCD analysis of AF488-PQBP1, AF488-CPSF6 313-327 and fluorescein-dATP to CA A204C particles in the absence and presence of HCB, and to R18G or N74D CA particles. (C) The N-terminal 46 residues of PQBP1 bound strongly to capsid. TCCD binding analysis of GFP fusions of PQBP1 1-46 and PQBP1 47-265 to CA A204C particles in the absence and presence of HCB. Data are representative of at least two independent experiments. One-way ANOVA, **** p<0.0001, ns=no significance. (D) Fluorescence resonance energy transfer (FRET) assay to visualize interaction between PQBP1 and capsid of incoming virions. PMA-THP-1 cells stably expressing either eYFP, PQBP1_ 1-46 - eYFP or PQBP1_1 -104 -eYFP (blue) were infected with HIV-1 packaged with CypA-DsRed (red) for 1.5 hours, followed by PFA fixation, imaging, and FRET analysis. Representative images and distributions of FRET values normalized against an uninfected counterpart were shown (see Method for detail). FRET excitation and emission wavelengths for YFP and mCherry are as annotated. R0 calculated to be 60.98Å ( https://www.fpbase.org/fret/ ). Data are representative of at least two independent experiments.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: (A) Representative TCCD traces of AF488-PQBP1 (green) and AF568-labeled CA A204C particles (orange). The insets show schematics of the species detected by TCCD with PQBP1 and CA A204C particles represented as green stars and orange cones, respectively. Top, featureless PQBP1 trace due to the diffusion of PQBP1 monomers; middle, coincident peaks in both traces due to co-diffusion of multiple PQBP1 molecules bound to CA particles; bottom, featureless PQBP1 trace due to non-associated diffusion of PQBP1 monomers and CA particles in the presence of HCB. (B) PQBP1 binds to the R18 pore of capsid. TCCD analysis of AF488-PQBP1, AF488-CPSF6 313-327 and fluorescein-dATP to CA A204C particles in the absence and presence of HCB, and to R18G or N74D CA particles. (C) The N-terminal 46 residues of PQBP1 bound strongly to capsid. TCCD binding analysis of GFP fusions of PQBP1 1-46 and PQBP1 47-265 to CA A204C particles in the absence and presence of HCB. Data are representative of at least two independent experiments. One-way ANOVA, **** p<0.0001, ns=no significance. (D) Fluorescence resonance energy transfer (FRET) assay to visualize interaction between PQBP1 and capsid of incoming virions. PMA-THP-1 cells stably expressing either eYFP, PQBP1_ 1-46 - eYFP or PQBP1_1 -104 -eYFP (blue) were infected with HIV-1 packaged with CypA-DsRed (red) for 1.5 hours, followed by PFA fixation, imaging, and FRET analysis. Representative images and distributions of FRET values normalized against an uninfected counterpart were shown (see Method for detail). FRET excitation and emission wavelengths for YFP and mCherry are as annotated. R0 calculated to be 60.98Å ( https://www.fpbase.org/fret/ ). Data are representative of at least two independent experiments.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Labeling, Diffusion-based Assay, Binding Assay, Fluorescence, Förster Resonance Energy Transfer, Stable Transfection, Expressing, Infection, Imaging

(A) PQBP1 1-46 and PQBP1 47-265 with N-terminal eGFP or C-terminal sfGFP produced in a cell-free protein expression mixture before (left) and after (middle) purification by Ni-NTA chromatography followed by dialysis. Recombinant PQBP1 was labelled at C60 with AF488-maleimide (right). (B) Dual-color fluorescence traces of a negative control GFP (green traces) with AF568-labelled CA A204C particles (orange traces). (C) Top panels, representative fluorescence traces of either AF488 labelled PQBP1, CPSF6 peptide or dATP (red traces) and the CA A204C particles (blue traces). Inclusion of hexacarboxybenzene (HCB) or use of either N74D or R18G double mutants with CA A204C is indicated. Bottom panels, analogous to the top, except eGFP fused PQBP1 truncation constructs were utilized. (D) Fluorescence resonance energy transfer (FRET) assay to measure interaction between PQBP1 1-46 -YFP and CypA-dsRed. THP-1 cells either wild type or stably expressing either eYFP, PQBP1 1-46 -eYFP or PQBP1 1-104 -eYFP were infected with HIV-1 virus packaged with CypA-DsRed for 1.5 hrs, followed by PFA fixation and FRET analysis. Signal intensity distribution of CypA-dsRed positive foci for indicated THP-1 clones infected with the virus (left) and a western blot depicting expression of both eYFP and PQBP1-eYFP proteins are shown.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: (A) PQBP1 1-46 and PQBP1 47-265 with N-terminal eGFP or C-terminal sfGFP produced in a cell-free protein expression mixture before (left) and after (middle) purification by Ni-NTA chromatography followed by dialysis. Recombinant PQBP1 was labelled at C60 with AF488-maleimide (right). (B) Dual-color fluorescence traces of a negative control GFP (green traces) with AF568-labelled CA A204C particles (orange traces). (C) Top panels, representative fluorescence traces of either AF488 labelled PQBP1, CPSF6 peptide or dATP (red traces) and the CA A204C particles (blue traces). Inclusion of hexacarboxybenzene (HCB) or use of either N74D or R18G double mutants with CA A204C is indicated. Bottom panels, analogous to the top, except eGFP fused PQBP1 truncation constructs were utilized. (D) Fluorescence resonance energy transfer (FRET) assay to measure interaction between PQBP1 1-46 -YFP and CypA-dsRed. THP-1 cells either wild type or stably expressing either eYFP, PQBP1 1-46 -eYFP or PQBP1 1-104 -eYFP were infected with HIV-1 virus packaged with CypA-DsRed for 1.5 hrs, followed by PFA fixation and FRET analysis. Signal intensity distribution of CypA-dsRed positive foci for indicated THP-1 clones infected with the virus (left) and a western blot depicting expression of both eYFP and PQBP1-eYFP proteins are shown.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Produced, Expressing, Purification, Chromatography, Recombinant, Fluorescence, Negative Control, Construct, Förster Resonance Energy Transfer, Stable Transfection, Infection, Virus, Clone Assay, Western Blot

(A) cGAS and PQBP1 association with incoming viral particles. Single Z slice images of PMA-THP-1 cells infected with HIV-1 labeled with Gag-IN-mRuby3 (red) in the presence of VLP-Vpx coinfection for 1 hr, followed by antibody detection of PQBP1 protein (green) and cGAS (blue). Detailed cropped images of individual viral complexes associating with PQBP1 and cGAS at different levels and distributions are shown on the right. Fractions of total IN-mRuby3 foci showing association with PQBP1, cGAS (independently) and simultaneously positive for signals of viral particle, PQBP1, and cGAS are quantified at the bottom. (B) PQBP1 recruitment to viral particles precedes cGAS recruitment. MDDCs were infected with HIV-1 labeled with iGFP fluid phage marker and IN- mRuby3 at low MOI and subjected to a time-lapse imaging for an hour, followed by fixed IF for PQBP1 and cGAS. Signal intensity of PQBP1/cGAS for each viral particle are quantified and plotted according to the structural state of capsids, assessed by iGFP signal status (see Method, bottom graphs). Kruskal Wallis H; KW p<0.001), followed by Dunn’s multiple comparisons *** p<0.001, ** p<0.01. Data represent sum of 2 to 3 independent experiments. (C) PQBP1 is required for cGAS recruitment to viral particles. Top, PMA-THP-1, treated with either a non-targeting siRNA (NT) or siRNAs targeting PQBP1 (PQBP1-1 and -2), were infected with HIV-1 viruses (Gag-IN- mRuby3) for 2.5 hours, followed by fixed imaging for cGAS. NC denotes negative control where the cells were only stained with secondary antibodies. Mean fluorescence intensity (MFI) of cGAS signal per viral particle (IN) is quantified. Median and error bar (-/+ 1.5*IQR) are shown. Box indicates the interquartile range (IQR). Dunn’s column comparison **** p<0.0001. Bottom, relative ratio of viral particles (INs) where co-associating cGAS MFI signals above the maximum value of NC sample are plotted from the data shown in top graph. All the HIV-1 infections of PMA-THP-1 cells were performed in the presence of VLP-Vpx co-infection. (D) Knockdown of PQBP1 results in decreased cGAMP production. PMA-THP-1, transfected with non-targeting siRNAs (NT) or siRNA targeting PQBP1, were challenged with HIV-1 for 2.5 hours and stained for cGAMP (green), cGAS (red), and dapi (blue). Mean cGAMP signal per cell were graphed (bottom). Median and Error bar (-/+ 1.5*IQR) are shown. Box indicates the interquartile range (IQR). Mann-Whitney **** p<0.0001. Data are representative of three independent infections. All the data presented, unless otherwise stated, are representatives of at least two independent experiments.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: (A) cGAS and PQBP1 association with incoming viral particles. Single Z slice images of PMA-THP-1 cells infected with HIV-1 labeled with Gag-IN-mRuby3 (red) in the presence of VLP-Vpx coinfection for 1 hr, followed by antibody detection of PQBP1 protein (green) and cGAS (blue). Detailed cropped images of individual viral complexes associating with PQBP1 and cGAS at different levels and distributions are shown on the right. Fractions of total IN-mRuby3 foci showing association with PQBP1, cGAS (independently) and simultaneously positive for signals of viral particle, PQBP1, and cGAS are quantified at the bottom. (B) PQBP1 recruitment to viral particles precedes cGAS recruitment. MDDCs were infected with HIV-1 labeled with iGFP fluid phage marker and IN- mRuby3 at low MOI and subjected to a time-lapse imaging for an hour, followed by fixed IF for PQBP1 and cGAS. Signal intensity of PQBP1/cGAS for each viral particle are quantified and plotted according to the structural state of capsids, assessed by iGFP signal status (see Method, bottom graphs). Kruskal Wallis H; KW p<0.001), followed by Dunn’s multiple comparisons *** p<0.001, ** p<0.01. Data represent sum of 2 to 3 independent experiments. (C) PQBP1 is required for cGAS recruitment to viral particles. Top, PMA-THP-1, treated with either a non-targeting siRNA (NT) or siRNAs targeting PQBP1 (PQBP1-1 and -2), were infected with HIV-1 viruses (Gag-IN- mRuby3) for 2.5 hours, followed by fixed imaging for cGAS. NC denotes negative control where the cells were only stained with secondary antibodies. Mean fluorescence intensity (MFI) of cGAS signal per viral particle (IN) is quantified. Median and error bar (-/+ 1.5*IQR) are shown. Box indicates the interquartile range (IQR). Dunn’s column comparison **** p<0.0001. Bottom, relative ratio of viral particles (INs) where co-associating cGAS MFI signals above the maximum value of NC sample are plotted from the data shown in top graph. All the HIV-1 infections of PMA-THP-1 cells were performed in the presence of VLP-Vpx co-infection. (D) Knockdown of PQBP1 results in decreased cGAMP production. PMA-THP-1, transfected with non-targeting siRNAs (NT) or siRNA targeting PQBP1, were challenged with HIV-1 for 2.5 hours and stained for cGAMP (green), cGAS (red), and dapi (blue). Mean cGAMP signal per cell were graphed (bottom). Median and Error bar (-/+ 1.5*IQR) are shown. Box indicates the interquartile range (IQR). Mann-Whitney **** p<0.0001. Data are representative of three independent infections. All the data presented, unless otherwise stated, are representatives of at least two independent experiments.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Infection, Labeling, Marker, Imaging, Negative Control, Staining, Fluorescence, Comparison, Knockdown, Transfection, MANN-WHITNEY

(A) The specificity of cGAS antibody was confirmed by IF and western blot on cGAS knock out in THP-1 cells. (B) Time lapsed imaging to monitor the structural integrity of an incoming viral core. MDDCs are infected with HIV-1 virus with iGFP fluid phase marker (iGFP+IN-mRuby3 at low MOI) where iGFP and IN-mRuby signal intensities of each virion were monitored for one hour. See Video S1. A representative kinetic profile of the signal intensities of a virion at different stages where the loss of GFP signal linked to virion fusion and capsid integrity loss are depicted (top). Panels of each virion, identified by both time-lapsed and corresponding IF x-y-z position of the respective foci point label was categorized based on the capsid integrity status and are color coded for the signals of PQBP1 (green), cGAS (blue), IN-mRuby3 (red). The RGB merged images and iGFP (gray in the individual boxes) are also shown (middle, particle B to G). 3D reconstruction of point E and point F foci are shown where we see the proximity and overlapping of PQBP1/cGAS complexes to the viral particle. (C) A knock down efficiency of siRNAs against PQBP1 is demonstrated by both RT-qPCR and IF analysis (left and right respectively). MFI of cGAS signal intensity per THP-1 cell treated with either non-targeting (NT) or PQBP1 specific siRNAs and infected with HIV-1 virus as described in . Mean and error bar (-/+ 1.5*IQR) are shown. Boxes denote the interquartile range. T-test (two-tailed, equal variation), *p<0.05; Dunn’s column comparison **** p<0.0001, * p<0.05. (D) Increase in cGAMPs in the cytosol of the infected cells. PMA-THP-1 cells, either mock infected or infected with HIV-1 luciferase virus or transfected with either HT-DNA or cGAMP for 3 hours, were stained for cGAMP (green), p24 (red), IRF3 (magenta) and dapi (blue). The white contour line indicates the boundary of nucleus. (E) Knockdown of PQBP1 results decreased cGAMP production. Left, PMA-THP-1, transfected with non-targeting siRNAs (NT) or siRNA targeting PQBP1, were challenged with HIV-1, stained for cGAMP (green), cGAS (red), and dapi (blue). Right, knockdown efficiencies of both mRNA and protein level of PQBP.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: (A) The specificity of cGAS antibody was confirmed by IF and western blot on cGAS knock out in THP-1 cells. (B) Time lapsed imaging to monitor the structural integrity of an incoming viral core. MDDCs are infected with HIV-1 virus with iGFP fluid phase marker (iGFP+IN-mRuby3 at low MOI) where iGFP and IN-mRuby signal intensities of each virion were monitored for one hour. See Video S1. A representative kinetic profile of the signal intensities of a virion at different stages where the loss of GFP signal linked to virion fusion and capsid integrity loss are depicted (top). Panels of each virion, identified by both time-lapsed and corresponding IF x-y-z position of the respective foci point label was categorized based on the capsid integrity status and are color coded for the signals of PQBP1 (green), cGAS (blue), IN-mRuby3 (red). The RGB merged images and iGFP (gray in the individual boxes) are also shown (middle, particle B to G). 3D reconstruction of point E and point F foci are shown where we see the proximity and overlapping of PQBP1/cGAS complexes to the viral particle. (C) A knock down efficiency of siRNAs against PQBP1 is demonstrated by both RT-qPCR and IF analysis (left and right respectively). MFI of cGAS signal intensity per THP-1 cell treated with either non-targeting (NT) or PQBP1 specific siRNAs and infected with HIV-1 virus as described in . Mean and error bar (-/+ 1.5*IQR) are shown. Boxes denote the interquartile range. T-test (two-tailed, equal variation), *p<0.05; Dunn’s column comparison **** p<0.0001, * p<0.05. (D) Increase in cGAMPs in the cytosol of the infected cells. PMA-THP-1 cells, either mock infected or infected with HIV-1 luciferase virus or transfected with either HT-DNA or cGAMP for 3 hours, were stained for cGAMP (green), p24 (red), IRF3 (magenta) and dapi (blue). The white contour line indicates the boundary of nucleus. (E) Knockdown of PQBP1 results decreased cGAMP production. Left, PMA-THP-1, transfected with non-targeting siRNAs (NT) or siRNA targeting PQBP1, were challenged with HIV-1, stained for cGAMP (green), cGAS (red), and dapi (blue). Right, knockdown efficiencies of both mRNA and protein level of PQBP.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Western Blot, Knock-Out, Imaging, Infection, Virus, Marker, Knockdown, Quantitative RT-PCR, Two Tailed Test, Comparison, Luciferase, Transfection, Staining

(A) NONO is required for the HIV-1 infection induced ISG54 induction in MDDCs. Cells targeted by the indicated siRNAs were either mock-treated or infected with HIV-1 luciferase virus, followed by ISG54 mRNA measurement 16 hrs post infection. (B) NONO is not required for ISG54 induction against HIV-1 infection in PMA differentiated THP-1 cells. Left, Cells were subjected to CRISPR gene editing with indicated sgRNAs and assessed for ISG54 mRNA inductions at 16 hours post infection with either mock, HIV-1 in the presence of VLP-Vpx or HIV-2. Right, the levels of NONO and PQBP1 proteins of the cells targeted with indicated sgRNAs were shown accordingly. (C) Left, representative image of MDDCs infected with HIV-1 virus (IN-mRuby3) and stained for PQBP1 (blue) and NONO (green). Right, distribution of IN-to-NONO (top) or IN-to-PQBP1 (bottom) nearest neighbor distances ( d ). The distribution of experimental data (blue histograms) is compared with one generated from in silico randomized dots (magenta histograms). A kernel density estimate of each distribution is overplotted as a solid curve, represented as Frequency, N=27,932 INs. The percentage of INs that have either PQBP1 or NONO at d < 0.5 µm as well as the values for the randomized controls are graphed bottom left. (D) NONO depletion does not impair cGAS recruitment to incoming capsids. MDDCs treated with indicated siRNAs were infected with HIV-1 viruses (Gag-IN-mRuby3/GFP) for 2.5 hours, followed by immunostaining for cGAS and imaging. Fractions of total IN foci overlap with cGAS signal are graphed. Mean and SEM are shown. One-way ANOVA, *** p<0.001. The results are based on and four independent experiments. (E) NONO is not required for cGAS recruitment to capsid in PMA-THP-1 cells. Efficiency of Flag-cGAS and p24 viral capsid interaction in PMA-THP-1 cells targeted by indicated siRNAs was determined by a proximal ligation assay (PLA). The cells were infected with HIV-1 virus in the presence of VLP-Vpx for 2 hrs followed by paraformaldehyde fixation and PLA. Representative images (left) and quantification (right) of PLA dots (red) per cells are shown. Dapi (blue) and cell boundary (dotted line) are shown. Mean and SEM are shown. One-way ANOVA, **** p<0.0001. ns denotes no significance. (F) cGAMP production upon HIV-1 infection is not impaired by depletion of NONO. MDDCs, transfected with indicated siRNAs, were challenged with HIV-1 for 2.5 hours and were stained for cGAMP (green) and dapi (blue). Mean cGAMP signal per cell were graphed (bottom). Mean and SEM are shown. One-way ANOVA, ** p<0.01, *** p<0.001, ns denotes no significance. All the data, unless noted otherwise, are representative of at least two independent experiments.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: (A) NONO is required for the HIV-1 infection induced ISG54 induction in MDDCs. Cells targeted by the indicated siRNAs were either mock-treated or infected with HIV-1 luciferase virus, followed by ISG54 mRNA measurement 16 hrs post infection. (B) NONO is not required for ISG54 induction against HIV-1 infection in PMA differentiated THP-1 cells. Left, Cells were subjected to CRISPR gene editing with indicated sgRNAs and assessed for ISG54 mRNA inductions at 16 hours post infection with either mock, HIV-1 in the presence of VLP-Vpx or HIV-2. Right, the levels of NONO and PQBP1 proteins of the cells targeted with indicated sgRNAs were shown accordingly. (C) Left, representative image of MDDCs infected with HIV-1 virus (IN-mRuby3) and stained for PQBP1 (blue) and NONO (green). Right, distribution of IN-to-NONO (top) or IN-to-PQBP1 (bottom) nearest neighbor distances ( d ). The distribution of experimental data (blue histograms) is compared with one generated from in silico randomized dots (magenta histograms). A kernel density estimate of each distribution is overplotted as a solid curve, represented as Frequency, N=27,932 INs. The percentage of INs that have either PQBP1 or NONO at d < 0.5 µm as well as the values for the randomized controls are graphed bottom left. (D) NONO depletion does not impair cGAS recruitment to incoming capsids. MDDCs treated with indicated siRNAs were infected with HIV-1 viruses (Gag-IN-mRuby3/GFP) for 2.5 hours, followed by immunostaining for cGAS and imaging. Fractions of total IN foci overlap with cGAS signal are graphed. Mean and SEM are shown. One-way ANOVA, *** p<0.001. The results are based on and four independent experiments. (E) NONO is not required for cGAS recruitment to capsid in PMA-THP-1 cells. Efficiency of Flag-cGAS and p24 viral capsid interaction in PMA-THP-1 cells targeted by indicated siRNAs was determined by a proximal ligation assay (PLA). The cells were infected with HIV-1 virus in the presence of VLP-Vpx for 2 hrs followed by paraformaldehyde fixation and PLA. Representative images (left) and quantification (right) of PLA dots (red) per cells are shown. Dapi (blue) and cell boundary (dotted line) are shown. Mean and SEM are shown. One-way ANOVA, **** p<0.0001. ns denotes no significance. (F) cGAMP production upon HIV-1 infection is not impaired by depletion of NONO. MDDCs, transfected with indicated siRNAs, were challenged with HIV-1 for 2.5 hours and were stained for cGAMP (green) and dapi (blue). Mean cGAMP signal per cell were graphed (bottom). Mean and SEM are shown. One-way ANOVA, ** p<0.01, *** p<0.001, ns denotes no significance. All the data, unless noted otherwise, are representative of at least two independent experiments.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Infection, Luciferase, Virus, CRISPR, Staining, Generated, In Silico, Immunostaining, Imaging, Ligation, Transfection

(A) PMA differentiated THP-1 cells, subjected to siRNA-mediated targeting were infected with were with either mock of HIV-1 in the presence of VLP-Vpx for 2 hrs, followed by post-fixation IF imaging. The level of NONO and PQBP1 proteins of the indicated THP-1 cells (top) and expression levels of Flag-cGAS (red), p24 (green) and Dapi (blue) of the cells utilized for proximal ligation assay as in (bottom) are shown. (B) Knockdown efficiencies of siRNA-targeted genes in MDDCs were quantified by RT-qPCR. (C) MFIs of cGAS signal per infected MDDC, subjected to indicated siRNA treatments, are shown. A table at the bottom of the graph shows # of INs analyzed for each condition. (D) Representative images of the infected MDDCs having treated with indicated siRNAs (left) and MFI of indicated protein signals per cells (right) analyzed in and are shown. Mean and SEMs are shown. One-way ANOVA, ***p<0.001, **p<0.01, *p<0.05. ns denotes no significance.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: (A) PMA differentiated THP-1 cells, subjected to siRNA-mediated targeting were infected with were with either mock of HIV-1 in the presence of VLP-Vpx for 2 hrs, followed by post-fixation IF imaging. The level of NONO and PQBP1 proteins of the indicated THP-1 cells (top) and expression levels of Flag-cGAS (red), p24 (green) and Dapi (blue) of the cells utilized for proximal ligation assay as in (bottom) are shown. (B) Knockdown efficiencies of siRNA-targeted genes in MDDCs were quantified by RT-qPCR. (C) MFIs of cGAS signal per infected MDDC, subjected to indicated siRNA treatments, are shown. A table at the bottom of the graph shows # of INs analyzed for each condition. (D) Representative images of the infected MDDCs having treated with indicated siRNAs (left) and MFI of indicated protein signals per cells (right) analyzed in and are shown. Mean and SEMs are shown. One-way ANOVA, ***p<0.001, **p<0.01, *p<0.05. ns denotes no significance.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Infection, Imaging, Expressing, Ligation, Knockdown, Quantitative RT-PCR

Either full-length or truncated PQBP1-YFP proteins were co-expressed with MBP- cGAS in 293T cells and subjected to anti-MBP pull down. *ns denotes non-specific protein. A schematic of PQBP1 protein is shown. WWD and E/D denote ww domain and acidic aa rich domain respectively.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: Either full-length or truncated PQBP1-YFP proteins were co-expressed with MBP- cGAS in 293T cells and subjected to anti-MBP pull down. *ns denotes non-specific protein. A schematic of PQBP1 protein is shown. WWD and E/D denote ww domain and acidic aa rich domain respectively.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques:

HIV-1 infection enhances PQBP1 and cGAS interaction. (A) PMA-THP-1 cells were fixed 2.5 hours post HIV-1 infection (Gag-IN-mRuby) or HT DNA transfection, followed by immunostaining against PQBP1 and cGAS and for confocal microscopy. Z-section images (left) and the quantification of the co-association foci (right) are shown. A threshold for colocalization is set at a distance of 0.4 µm. Averages and SEM are shown. One-way ANOVA, ** p<0.01, * p<0.05, ns denotes no significance. (B) HIV-1 infection (+) enhances co-immunoprecipitation of cGAS or Flag-cGAS with PQBP-IP in MDDCs (left) or PMA-THP-1 (middle and right), respectively. The cells were infected with HIV-1 luciferase virus in the presence of VLP-Vpx and subjected to co- IPs at 3 hrs post infection. HT-DNA was delivered to PMA-THP-1 cells instead of the viral infection and endogenous cGAS co-precipitating with PQBP1 was assayed. 1x and 3 x denote the relative amounts of inputs loaded on a gel. Normal IgG (NS) or antibody against PQBP1 were used as indicated. ns denotes non-specific bands. (C) The capsid interaction domain of PQBP1 is a dominant inhibitor of cGAS-mediated innate sensing of HIV-1 infection. Two independent PMA- THP-1 cell clones (A and B clones) stably expressing either YFP, PQBP1_ 1-46- YFP or PQBP1_ 1-104- YFP were infected with HIV-1 luciferase virus in the presence of VLP-Vpx or Sendai virus as indicated. ISG54 mRNAs were measured 16 hours post infection. (D) The capsid interaction domain of PQBP1 is needed for innate response against HIV-1 infection. PMA-THP-1 cells either un-transduced or stably expressing the indicated PQBP1-YFP proteins were treated with siRNA against endogenous PQBP1 (+), followed by HIV-1 infection and ISG54 mRNA detection as in (C). NT denotes non-targeting siRNA. ISG54 mRNA levels were expressed as a fold induction over their uninfected counterparts. Expression level of either YFP or PQBP-YFPs in the cells used in (C) and (D) were determined by anti-GFP/YFP western blots. Equal numbers of cells were analyzed. T-test (unpaired; two-tailed) *p<0.05, **p<0.01, ***p<0.001. All the data, unless noted otherwise, are representative of at least two independent experiments.

Journal: bioRxiv

Article Title: Recognition of HIV-1 Capsid Licenses Innate Immune Response to Viral Infection

doi: 10.1101/2022.01.10.472699

Figure Lengend Snippet: HIV-1 infection enhances PQBP1 and cGAS interaction. (A) PMA-THP-1 cells were fixed 2.5 hours post HIV-1 infection (Gag-IN-mRuby) or HT DNA transfection, followed by immunostaining against PQBP1 and cGAS and for confocal microscopy. Z-section images (left) and the quantification of the co-association foci (right) are shown. A threshold for colocalization is set at a distance of 0.4 µm. Averages and SEM are shown. One-way ANOVA, ** p<0.01, * p<0.05, ns denotes no significance. (B) HIV-1 infection (+) enhances co-immunoprecipitation of cGAS or Flag-cGAS with PQBP-IP in MDDCs (left) or PMA-THP-1 (middle and right), respectively. The cells were infected with HIV-1 luciferase virus in the presence of VLP-Vpx and subjected to co- IPs at 3 hrs post infection. HT-DNA was delivered to PMA-THP-1 cells instead of the viral infection and endogenous cGAS co-precipitating with PQBP1 was assayed. 1x and 3 x denote the relative amounts of inputs loaded on a gel. Normal IgG (NS) or antibody against PQBP1 were used as indicated. ns denotes non-specific bands. (C) The capsid interaction domain of PQBP1 is a dominant inhibitor of cGAS-mediated innate sensing of HIV-1 infection. Two independent PMA- THP-1 cell clones (A and B clones) stably expressing either YFP, PQBP1_ 1-46- YFP or PQBP1_ 1-104- YFP were infected with HIV-1 luciferase virus in the presence of VLP-Vpx or Sendai virus as indicated. ISG54 mRNAs were measured 16 hours post infection. (D) The capsid interaction domain of PQBP1 is needed for innate response against HIV-1 infection. PMA-THP-1 cells either un-transduced or stably expressing the indicated PQBP1-YFP proteins were treated with siRNA against endogenous PQBP1 (+), followed by HIV-1 infection and ISG54 mRNA detection as in (C). NT denotes non-targeting siRNA. ISG54 mRNA levels were expressed as a fold induction over their uninfected counterparts. Expression level of either YFP or PQBP-YFPs in the cells used in (C) and (D) were determined by anti-GFP/YFP western blots. Equal numbers of cells were analyzed. T-test (unpaired; two-tailed) *p<0.05, **p<0.01, ***p<0.001. All the data, unless noted otherwise, are representative of at least two independent experiments.

Article Snippet: The following antibodies were used: IRF3 (Cell Signaling D9J5Q), PQBP1 [Bethyl Laboratory A302-802A; Santa Cruz Biotechnology sc-376039; Sigma Aldrich (1A11)], cGAS [Novus NBP1- 8676; Santa Cruz Biotechnology (D-9); Cayman (5G10); Cell signaling (D1D3G)], normal rabbit/mouse IgG (Santa Cruz Biotechnology SC-2027), β-actin (Cell Signaling Technology 49705), GFP (Thermo Scientific MA5-15256: Clontech 632592), FLAG (Sigma Aldrich F1804), p24 (AIDS Reagent 71-31).

Techniques: Infection, Transfection, Immunostaining, Confocal Microscopy, Immunoprecipitation, Luciferase, Virus, Clone Assay, Stable Transfection, Expressing, Western Blot, Two Tailed Test

(A) IL-1β release of LPS-primed wt Balb/c iBMDMs treated with Dyngo-4a, Dynasore (40/ 80/ 160 µM), ATP (2 mM) or Nigericin (2 µM) for 90 min; n = 3. (B) IL-1β release of LPS-primed C57Bl6 BMDMs stimulated with Nigericin (2 µM), Dyngo-4a (80 µM) or Dynasore (160 µM) in presence of excessive KCl (0-80 mM) or the Caspase-1 inhibitor VX-765 (10 µM); n = 3 (C) Quantification of intracellular K + via ion-selective electrode measurement. MCC-950 indicates Nlrp3 inhibitor treatment. (D) Representative Western blot for cleaved (p20) and uncleaved (p45) caspase-1 from primary C57Bl6 BMDM supernatants; n = 3 (E) As in C, but in presence of increasing concentrations of KCl; n = 3. (F) Representative Western blot for mature and pro-IL-1β in presence or absence of excess 80 mM KCl in wt Balb/C iBMDMs, NLRP3- or Caspase-1/11 deficient iBMDMs, treated with 80 µM Dynasore, 10 µM Nigericin, 60 µg/ml R837 (left) or 20/ 40/ 80 µM Dynasore or Dyngo-4a (right); n = 2. (G) Relative AlexaFlour-647 labelled transferrin (Tfn, left) or AlexaFlour-594 labelled Choleratoxin-B (CtxB, right) uptake in ASC -/- iBMDMs in the presence of Dyngo-4a or Dynasore; n = 3 (H) Enrichment analysis for GOCC terms and Uniprot keywords using Fisher exact test on proteins significantly (p < 0.05; FDR < 0.02) changing localization in ASC -/- iBMDMs in presence of Dyngo-4a (80 µM), Dynasore (160 µM) or Nigericin (2 µM) relative to LPS-primed control. (I) Profile plots showing relative AP2-complex subunit (AP2a1, AP2a2, AP2b1, AP2m1, AP2s1) distribution across fractions. (J) 3D-Principal-component-analysis showing transition of AP2-complex subunits (grey-LPS, black-Nigericin, movement indicated by lines) upon 80 µM Dyngo-4a (left) or 160 µM Dynasore (right) treatment with annotations for endosomal (red), Golgi- (orange) or plasma membrane proteins (violet). (K) Representative confocal microscopy images of LPS-primed ASC -/- iBMDMs stably expressing functional AP2a1-eGFP-AP2b1 fusion protein and transiently expressing NLRP3-tagRFP, co-stained with DAPI. Statistics indicate significance by student’s two-tailed t-test (A, B, C, F, G).

Journal: bioRxiv

Article Title: NLRP3 activators disrupt the endocytic AP2 complex and plasma membrane signaling

doi: 10.64898/2026.02.24.707400

Figure Lengend Snippet: (A) IL-1β release of LPS-primed wt Balb/c iBMDMs treated with Dyngo-4a, Dynasore (40/ 80/ 160 µM), ATP (2 mM) or Nigericin (2 µM) for 90 min; n = 3. (B) IL-1β release of LPS-primed C57Bl6 BMDMs stimulated with Nigericin (2 µM), Dyngo-4a (80 µM) or Dynasore (160 µM) in presence of excessive KCl (0-80 mM) or the Caspase-1 inhibitor VX-765 (10 µM); n = 3 (C) Quantification of intracellular K + via ion-selective electrode measurement. MCC-950 indicates Nlrp3 inhibitor treatment. (D) Representative Western blot for cleaved (p20) and uncleaved (p45) caspase-1 from primary C57Bl6 BMDM supernatants; n = 3 (E) As in C, but in presence of increasing concentrations of KCl; n = 3. (F) Representative Western blot for mature and pro-IL-1β in presence or absence of excess 80 mM KCl in wt Balb/C iBMDMs, NLRP3- or Caspase-1/11 deficient iBMDMs, treated with 80 µM Dynasore, 10 µM Nigericin, 60 µg/ml R837 (left) or 20/ 40/ 80 µM Dynasore or Dyngo-4a (right); n = 2. (G) Relative AlexaFlour-647 labelled transferrin (Tfn, left) or AlexaFlour-594 labelled Choleratoxin-B (CtxB, right) uptake in ASC -/- iBMDMs in the presence of Dyngo-4a or Dynasore; n = 3 (H) Enrichment analysis for GOCC terms and Uniprot keywords using Fisher exact test on proteins significantly (p < 0.05; FDR < 0.02) changing localization in ASC -/- iBMDMs in presence of Dyngo-4a (80 µM), Dynasore (160 µM) or Nigericin (2 µM) relative to LPS-primed control. (I) Profile plots showing relative AP2-complex subunit (AP2a1, AP2a2, AP2b1, AP2m1, AP2s1) distribution across fractions. (J) 3D-Principal-component-analysis showing transition of AP2-complex subunits (grey-LPS, black-Nigericin, movement indicated by lines) upon 80 µM Dyngo-4a (left) or 160 µM Dynasore (right) treatment with annotations for endosomal (red), Golgi- (orange) or plasma membrane proteins (violet). (K) Representative confocal microscopy images of LPS-primed ASC -/- iBMDMs stably expressing functional AP2a1-eGFP-AP2b1 fusion protein and transiently expressing NLRP3-tagRFP, co-stained with DAPI. Statistics indicate significance by student’s two-tailed t-test (A, B, C, F, G).

Article Snippet: For spatial proteomics experiments, per replicate, approximately 100×10 6 Casp1/11 -/- or Asc -/- SILAC-heavy or -light labelled iBMDMs were primed with 1 μg/ml LPS-EB or LPS-EB Ultrapure from E. coli 0111:B4 (InvivoGen, #tlrl-eblps or #tlrl-3pelps) in CM for 4 h at 37°C, 5% CO 2 , followed by stimulation in serum free conditions with either 10 μM Nigericin (NI; Thermo Fisher Scientific, #N1495), 60 μg/ml R837/Imiquimod (InvivoGen, #tlrl-imqs-1), 10 μM monensin (Merck, #M5273), Mdivi-1 (Selleckchem, #S7162), K + -free Hank’s balanced salt solution (HBSS), 160 μM Dynasore (DS; Selleckchem, #S8047), 80 μM Dyngo-4a (DN; Selleckchem, #S7163), or serum-free DMEM as control.

Techniques: Western Blot, Control, Clinical Proteomics, Membrane, Confocal Microscopy, Stable Transfection, Expressing, Functional Assay, Staining, Two Tailed Test

(A) IL-1β release of LPS-primed human monocyte-derived macrophages stimulated with 160 µM Dynasore ± 10 µM MCC-950 or 80 µM Dyngo-4a. Statistics indicate significance by student’s two-tailed t-test. (B) Western blot analysis of alpha-adaptin (AP2a1) in LPS-primed ASC -/- iBMDMs after stimulation with 80 µM Dynasore, 40 µM Dyngo-4a or 2 µM Nigericin, using 10 µg protein per fraction per condition for individual centrifugation speeds after subcellular fractionation.(C) Western blot analysis of alpha-adaptin (AP2a1) in LPS-primed ASC -/- iBMDMs after stimulation with 2 µM Nigericin, 10 µM chloroquine, 5 µM bafilomycin-4a, 10 µM FCCP or 1 µM wortmannin using 10 µg protein per fraction per condition for individual centrifugation speeds after subcellular fractionation. (D) Reactive oxygen species analysis of CM-H2DCFDA-stained ASC -/- iBMDMs treated with 10 µM Nigericin, 60 µg/ml R837, 80 µM Dynasore or 40 µM Dyngo-4a for 60 min. Shown is mean fluorescent intensity. (E) IL-1β release of LPS-primed C57Bl5 BMDMs in medium or treated with a mitochondrial Dynamin DRP1-inhibitor Mdivi-1, 40 µM for 90 min. n = 3. (F) Conventional cytokine (TNFa or IL-6) and IL-1β release of LPS-primed iBMDMs treated with 80 µM Dynasore (DS), 40 µM Dyngo-4a (DN), 10 µM Nigericin (NI), 60 µg/ml R837 or 2 µM ATP or in combination with 10 µM MCC-950; n = 2. (G) Heatmap of mean fold change per fraction of proteins that change significantly comparing Dynasore to LPS, Nigericin to LPS and Dynasore to Dyngo-4a in 3 out of 3 replicates. (H) Median IL-1β release in time- and dose-titration of Dynasore treatment in wt or NLRP3-deficient iBMDMs, determined via ELISA. n = 3. (I) IL-1β release of LPS-primed iBMDMs which were depleted of NLRP1, AIM2, Caspase-1, Caspase-11 and ASC by siRNA stimulated with 160 µM Dynasore ± 10 µM MCC-950 or 80 µM or 2 µM Nigericin.

Journal: bioRxiv

Article Title: NLRP3 activators disrupt the endocytic AP2 complex and plasma membrane signaling

doi: 10.64898/2026.02.24.707400

Figure Lengend Snippet: (A) IL-1β release of LPS-primed human monocyte-derived macrophages stimulated with 160 µM Dynasore ± 10 µM MCC-950 or 80 µM Dyngo-4a. Statistics indicate significance by student’s two-tailed t-test. (B) Western blot analysis of alpha-adaptin (AP2a1) in LPS-primed ASC -/- iBMDMs after stimulation with 80 µM Dynasore, 40 µM Dyngo-4a or 2 µM Nigericin, using 10 µg protein per fraction per condition for individual centrifugation speeds after subcellular fractionation.(C) Western blot analysis of alpha-adaptin (AP2a1) in LPS-primed ASC -/- iBMDMs after stimulation with 2 µM Nigericin, 10 µM chloroquine, 5 µM bafilomycin-4a, 10 µM FCCP or 1 µM wortmannin using 10 µg protein per fraction per condition for individual centrifugation speeds after subcellular fractionation. (D) Reactive oxygen species analysis of CM-H2DCFDA-stained ASC -/- iBMDMs treated with 10 µM Nigericin, 60 µg/ml R837, 80 µM Dynasore or 40 µM Dyngo-4a for 60 min. Shown is mean fluorescent intensity. (E) IL-1β release of LPS-primed C57Bl5 BMDMs in medium or treated with a mitochondrial Dynamin DRP1-inhibitor Mdivi-1, 40 µM for 90 min. n = 3. (F) Conventional cytokine (TNFa or IL-6) and IL-1β release of LPS-primed iBMDMs treated with 80 µM Dynasore (DS), 40 µM Dyngo-4a (DN), 10 µM Nigericin (NI), 60 µg/ml R837 or 2 µM ATP or in combination with 10 µM MCC-950; n = 2. (G) Heatmap of mean fold change per fraction of proteins that change significantly comparing Dynasore to LPS, Nigericin to LPS and Dynasore to Dyngo-4a in 3 out of 3 replicates. (H) Median IL-1β release in time- and dose-titration of Dynasore treatment in wt or NLRP3-deficient iBMDMs, determined via ELISA. n = 3. (I) IL-1β release of LPS-primed iBMDMs which were depleted of NLRP1, AIM2, Caspase-1, Caspase-11 and ASC by siRNA stimulated with 160 µM Dynasore ± 10 µM MCC-950 or 80 µM or 2 µM Nigericin.

Article Snippet: For spatial proteomics experiments, per replicate, approximately 100×10 6 Casp1/11 -/- or Asc -/- SILAC-heavy or -light labelled iBMDMs were primed with 1 μg/ml LPS-EB or LPS-EB Ultrapure from E. coli 0111:B4 (InvivoGen, #tlrl-eblps or #tlrl-3pelps) in CM for 4 h at 37°C, 5% CO 2 , followed by stimulation in serum free conditions with either 10 μM Nigericin (NI; Thermo Fisher Scientific, #N1495), 60 μg/ml R837/Imiquimod (InvivoGen, #tlrl-imqs-1), 10 μM monensin (Merck, #M5273), Mdivi-1 (Selleckchem, #S7162), K + -free Hank’s balanced salt solution (HBSS), 160 μM Dynasore (DS; Selleckchem, #S8047), 80 μM Dyngo-4a (DN; Selleckchem, #S7163), or serum-free DMEM as control.

Techniques: Derivative Assay, Two Tailed Test, Western Blot, Centrifugation, Fractionation, Staining, Titration, Enzyme-linked Immunosorbent Assay

(A) Chemical structure of biotinylated Dynasore (left) and Dyngo-4a (right). (B) 1D-annotation enrichment of fold changes comparing iBMDMs treated with 100 µM bitoin-Dynasore (right) or 100 µM biotin-Dyngo-4a (left). (C) Heatmap of protein expression of knockdown targets in unprimed iBMDMs 48 h after siRNA-mediated knockdown. Shown are log2-transformed median LFQ values of n = 3; fold reduction for AP2a1 = 91.63%; NME1 = 83.65%; NME2 = 76.28%, NME3, 4 and AP2a1 were not detected after knockdown. (D) Viability (mean) of LPS-primed iBMDMs treated with the NLRC4 agonist BsaK alone, in combination with VX-765, MCC-950 or 10 µM Nigericin; n = 3. (E) Heatmap of individual regulated phosphosites according to the keywords in . (F) As F, but adjacent to .

Journal: bioRxiv

Article Title: NLRP3 activators disrupt the endocytic AP2 complex and plasma membrane signaling

doi: 10.64898/2026.02.24.707400

Figure Lengend Snippet: (A) Chemical structure of biotinylated Dynasore (left) and Dyngo-4a (right). (B) 1D-annotation enrichment of fold changes comparing iBMDMs treated with 100 µM bitoin-Dynasore (right) or 100 µM biotin-Dyngo-4a (left). (C) Heatmap of protein expression of knockdown targets in unprimed iBMDMs 48 h after siRNA-mediated knockdown. Shown are log2-transformed median LFQ values of n = 3; fold reduction for AP2a1 = 91.63%; NME1 = 83.65%; NME2 = 76.28%, NME3, 4 and AP2a1 were not detected after knockdown. (D) Viability (mean) of LPS-primed iBMDMs treated with the NLRC4 agonist BsaK alone, in combination with VX-765, MCC-950 or 10 µM Nigericin; n = 3. (E) Heatmap of individual regulated phosphosites according to the keywords in . (F) As F, but adjacent to .

Article Snippet: For spatial proteomics experiments, per replicate, approximately 100×10 6 Casp1/11 -/- or Asc -/- SILAC-heavy or -light labelled iBMDMs were primed with 1 μg/ml LPS-EB or LPS-EB Ultrapure from E. coli 0111:B4 (InvivoGen, #tlrl-eblps or #tlrl-3pelps) in CM for 4 h at 37°C, 5% CO 2 , followed by stimulation in serum free conditions with either 10 μM Nigericin (NI; Thermo Fisher Scientific, #N1495), 60 μg/ml R837/Imiquimod (InvivoGen, #tlrl-imqs-1), 10 μM monensin (Merck, #M5273), Mdivi-1 (Selleckchem, #S7162), K + -free Hank’s balanced salt solution (HBSS), 160 μM Dynasore (DS; Selleckchem, #S8047), 80 μM Dyngo-4a (DN; Selleckchem, #S7163), or serum-free DMEM as control.

Techniques: Expressing, Knockdown, Transformation Assay

(A) Volcano-plot of streptavidin-bead-based pulldown from LPS-primed ASC -/- iBMDMs treated for 90 min with 100 µM biotin-Dynasore to 100 µM biotin-Dyngo-4a, comparing log2-transformed label-free quantification (LFQ)-intensities student’s t-test fold-enrichment and statistical significance; n = 3. (B) Heatmap showing log2-transformed LFQ-intensities of top-10 enriched interactors in cells treated with biotin-Dynasore compared to biotin-Dyngo-4a across compound concentrations (200, 100, 40, 10, 1, 0 µM biotin-Dynasore; 100, 50, 10, 1, 0 µM biotin-Dyngo-4a). (C) Fold IL-1β release of LPS-primed wt Balb/c iBMDMs 48 h after siRNA-mediated knockdown (5 nM) of the indicated genes stimulated with Nigericin (10 µM) or Dynasore (80 µM); n = 3. Statistics indicate significance by student’s two-tailed t-test (P < 0.01)). (D) Structure prediction of Dynasore in complex with hNME1 with Alphafold3. (E) IL-1β release of LPS-primed Balb/c iBMDMs expressing doxycycline-inducible NME1 fused to a mitochondrial targeting sequence peptide (COX8a). Statistics indicate significance by student’s two-tailed t-test (P < 0.01)). (F) IL-1β release of LPS-primed Balb/c iBMDMs expressing dominant negative Histidine118 mutants of NME2 in response to Dyngo-4a (80 µM) or Dynasore (80 µM). Statistics indicate significance by student’s two-tailed t-test; n = 3. (G-J) Phosphoproteomics analysis of inflammasome-stimulated Nlrp3 -/- iBMDMs. (G) Reference profiles for Pearson’s correlation clustering analysis of log2-transfomred, z-scored 8788 significantly regulated phosphosites across all conditions (One-way ANOVA, S 0 =1, FDR = 0.01) to determine top 500 downregulated phosphosites upon activation as shown in heatmap below. (H) As in (G) for upregulated phosphosites. (I) Enrichment analysis for Uniprot keywords using Fisher exact test on top 500 down- or (J) upregulated phosphosites compared to all 34530 identified phosphopeptides with an enrichment factor > 2.

Journal: bioRxiv

Article Title: NLRP3 activators disrupt the endocytic AP2 complex and plasma membrane signaling

doi: 10.64898/2026.02.24.707400

Figure Lengend Snippet: (A) Volcano-plot of streptavidin-bead-based pulldown from LPS-primed ASC -/- iBMDMs treated for 90 min with 100 µM biotin-Dynasore to 100 µM biotin-Dyngo-4a, comparing log2-transformed label-free quantification (LFQ)-intensities student’s t-test fold-enrichment and statistical significance; n = 3. (B) Heatmap showing log2-transformed LFQ-intensities of top-10 enriched interactors in cells treated with biotin-Dynasore compared to biotin-Dyngo-4a across compound concentrations (200, 100, 40, 10, 1, 0 µM biotin-Dynasore; 100, 50, 10, 1, 0 µM biotin-Dyngo-4a). (C) Fold IL-1β release of LPS-primed wt Balb/c iBMDMs 48 h after siRNA-mediated knockdown (5 nM) of the indicated genes stimulated with Nigericin (10 µM) or Dynasore (80 µM); n = 3. Statistics indicate significance by student’s two-tailed t-test (P < 0.01)). (D) Structure prediction of Dynasore in complex with hNME1 with Alphafold3. (E) IL-1β release of LPS-primed Balb/c iBMDMs expressing doxycycline-inducible NME1 fused to a mitochondrial targeting sequence peptide (COX8a). Statistics indicate significance by student’s two-tailed t-test (P < 0.01)). (F) IL-1β release of LPS-primed Balb/c iBMDMs expressing dominant negative Histidine118 mutants of NME2 in response to Dyngo-4a (80 µM) or Dynasore (80 µM). Statistics indicate significance by student’s two-tailed t-test; n = 3. (G-J) Phosphoproteomics analysis of inflammasome-stimulated Nlrp3 -/- iBMDMs. (G) Reference profiles for Pearson’s correlation clustering analysis of log2-transfomred, z-scored 8788 significantly regulated phosphosites across all conditions (One-way ANOVA, S 0 =1, FDR = 0.01) to determine top 500 downregulated phosphosites upon activation as shown in heatmap below. (H) As in (G) for upregulated phosphosites. (I) Enrichment analysis for Uniprot keywords using Fisher exact test on top 500 down- or (J) upregulated phosphosites compared to all 34530 identified phosphopeptides with an enrichment factor > 2.

Article Snippet: For spatial proteomics experiments, per replicate, approximately 100×10 6 Casp1/11 -/- or Asc -/- SILAC-heavy or -light labelled iBMDMs were primed with 1 μg/ml LPS-EB or LPS-EB Ultrapure from E. coli 0111:B4 (InvivoGen, #tlrl-eblps or #tlrl-3pelps) in CM for 4 h at 37°C, 5% CO 2 , followed by stimulation in serum free conditions with either 10 μM Nigericin (NI; Thermo Fisher Scientific, #N1495), 60 μg/ml R837/Imiquimod (InvivoGen, #tlrl-imqs-1), 10 μM monensin (Merck, #M5273), Mdivi-1 (Selleckchem, #S7162), K + -free Hank’s balanced salt solution (HBSS), 160 μM Dynasore (DS; Selleckchem, #S8047), 80 μM Dyngo-4a (DN; Selleckchem, #S7163), or serum-free DMEM as control.

Techniques: Transformation Assay, Quantitative Proteomics, Knockdown, Two Tailed Test, Expressing, Sequencing, Dominant Negative Mutation, Phospho-proteomics, Activation Assay

(A) Fluorescent microscopy of SNAP-β 2 AR-HEK293 cells at baseline (0 min) and 20 minutes after stimulation with 1 µM Isoproterenol +/- 30 µM Dyngo-4a, 60 µM Dynasore or 60 µg/ml R837. (B) Maximum of compound-induced (1 µM Isoproterenol, 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837) internalization of overexpressed SNAP-β 2 AR in HEK293 cells relative to buffer between 40 and 50 min measured as diffusion-enhanced resonance energy transfer (DERET). (C) Representative Over-time DERET of isoproterenol (100 nM/1 µM) induced SNAP-β 2 AR internalization in HEK293 cells subsequent to 30 min stimulation with 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837(left) and quantification as maximal response relative to buffer between 40 and 50 minutes shown as the mean ± SEM of four independent experiments (right). Statistics indicate significance by student’s two-tailed t-test. (D) Representative Over-time (left) isoproterenol-induced recruitment of β-arrestin 2 to β 2 V 2 in HEK293 cells measured as BRET between Flag-β 2 V 2 -YFP and Flag-β 2 V 2 -YFP after pre-stimulation with 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837or vehicle and quantification as maximal BRET amplitude, shown as the mean ± SEM of three independent experiments (right). Statistics indicate significance by student’s two-tailed t-test. (E) Over-time (left) and maximal (right) CCL19-induced recruitment of β-arrestin 1 to CCR7 in HEK293 cells pre-stimulated 60 µM Dynasore, 10 µM Nigericin, 60 µg/ml R837 or vehicle controls, quantified via bioluminescence resonance energy transfer (BRET). (F) Relative over-time Förster resonance energy transfer (FRET) in HEK293T cells expressing the dual biosensor mlCNBD-FRET after addition of norepinephrine (NE) in the indicated concentrations subsequent to preincubation with either 1% DMSO, 60 µM Dynasore, 30 µM Dyngo-4a; peak cAMP production in response to norepinephrine treatment in indicated concentrations (NE). Cells were pre-treated with DMSO, Dynasore, Dyngo-4a for 30 min before the experiment. (G) Representative Over-time dynamic mass redistribution in HEK293 cells stably expressing CCR7, induced by stimulation with 1 µM CCL19 subsequent to 30 min stimulation with 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837 (left) and quantification as the maximum wavelength shift as mean ± SEM of at least three independent experiments. (H) Velocity in [µm/min] and directionality of 50 dendritic cells per replicate during in-vitro 3D collagen migration assay over a timespan of 3 h after treatment with 1% DMSO, 160 µM Dynasore, 10 µM Dyngo-4a or 10 µM MCC-950; n = 4. Statistics indicate significance by Kruskal-Wallis test (n.s. = not significant, **** = P < 0.0001).

Journal: bioRxiv

Article Title: NLRP3 activators disrupt the endocytic AP2 complex and plasma membrane signaling

doi: 10.64898/2026.02.24.707400

Figure Lengend Snippet: (A) Fluorescent microscopy of SNAP-β 2 AR-HEK293 cells at baseline (0 min) and 20 minutes after stimulation with 1 µM Isoproterenol +/- 30 µM Dyngo-4a, 60 µM Dynasore or 60 µg/ml R837. (B) Maximum of compound-induced (1 µM Isoproterenol, 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837) internalization of overexpressed SNAP-β 2 AR in HEK293 cells relative to buffer between 40 and 50 min measured as diffusion-enhanced resonance energy transfer (DERET). (C) Representative Over-time DERET of isoproterenol (100 nM/1 µM) induced SNAP-β 2 AR internalization in HEK293 cells subsequent to 30 min stimulation with 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837(left) and quantification as maximal response relative to buffer between 40 and 50 minutes shown as the mean ± SEM of four independent experiments (right). Statistics indicate significance by student’s two-tailed t-test. (D) Representative Over-time (left) isoproterenol-induced recruitment of β-arrestin 2 to β 2 V 2 in HEK293 cells measured as BRET between Flag-β 2 V 2 -YFP and Flag-β 2 V 2 -YFP after pre-stimulation with 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837or vehicle and quantification as maximal BRET amplitude, shown as the mean ± SEM of three independent experiments (right). Statistics indicate significance by student’s two-tailed t-test. (E) Over-time (left) and maximal (right) CCL19-induced recruitment of β-arrestin 1 to CCR7 in HEK293 cells pre-stimulated 60 µM Dynasore, 10 µM Nigericin, 60 µg/ml R837 or vehicle controls, quantified via bioluminescence resonance energy transfer (BRET). (F) Relative over-time Förster resonance energy transfer (FRET) in HEK293T cells expressing the dual biosensor mlCNBD-FRET after addition of norepinephrine (NE) in the indicated concentrations subsequent to preincubation with either 1% DMSO, 60 µM Dynasore, 30 µM Dyngo-4a; peak cAMP production in response to norepinephrine treatment in indicated concentrations (NE). Cells were pre-treated with DMSO, Dynasore, Dyngo-4a for 30 min before the experiment. (G) Representative Over-time dynamic mass redistribution in HEK293 cells stably expressing CCR7, induced by stimulation with 1 µM CCL19 subsequent to 30 min stimulation with 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837 (left) and quantification as the maximum wavelength shift as mean ± SEM of at least three independent experiments. (H) Velocity in [µm/min] and directionality of 50 dendritic cells per replicate during in-vitro 3D collagen migration assay over a timespan of 3 h after treatment with 1% DMSO, 160 µM Dynasore, 10 µM Dyngo-4a or 10 µM MCC-950; n = 4. Statistics indicate significance by Kruskal-Wallis test (n.s. = not significant, **** = P < 0.0001).

Article Snippet: For spatial proteomics experiments, per replicate, approximately 100×10 6 Casp1/11 -/- or Asc -/- SILAC-heavy or -light labelled iBMDMs were primed with 1 μg/ml LPS-EB or LPS-EB Ultrapure from E. coli 0111:B4 (InvivoGen, #tlrl-eblps or #tlrl-3pelps) in CM for 4 h at 37°C, 5% CO 2 , followed by stimulation in serum free conditions with either 10 μM Nigericin (NI; Thermo Fisher Scientific, #N1495), 60 μg/ml R837/Imiquimod (InvivoGen, #tlrl-imqs-1), 10 μM monensin (Merck, #M5273), Mdivi-1 (Selleckchem, #S7162), K + -free Hank’s balanced salt solution (HBSS), 160 μM Dynasore (DS; Selleckchem, #S8047), 80 μM Dyngo-4a (DN; Selleckchem, #S7163), or serum-free DMEM as control.

Techniques: Microscopy, Diffusion-based Assay, Förster Resonance Energy Transfer, Two Tailed Test, Bioluminescence Resonance Energy Transfer, Expressing, Stable Transfection, In Vitro, Migration

(A) Representative over-time DERET of SNAP- β 2 -AR internalization in HEK293 cells overexpressing SNAP- β 2 -AR subsequent to stimulation with 60 µM Dynasore, 30 µM Dyngo-4a, 60 µg/ml R837 or 1 µM Isoproterenol. Data are shown as the mean ± SD of one representative experiment mean ± SD of one representative experiment. (B) Representative over-time DERET of 100 nM isoproterenol induced SNAP- β 2 -AR internalization in HEK293 cells overexpressing SNAP- β 2 -AR subsequent to pre-stimulation with 60 µM Dynasore, 30 µM Dyngo-4a, 60 µg/ml R837 Data are shown as the mean. (C) Over-time cAMP production in response to norepinephrine treatment in indicated concentrations (NE). Cells were treated with DMSO or R837 (60 µg/ml) for 30 min before the experiment. (D) Maximal isoproterenol-induced recruitment of nLuc-tagged β-arrestin 2 to wt - β 2 -AR in HEK293 cells and individual over-time traces measured as BRET between nLuc- β arrestin 2 and a plasma-membrane mVenus-tagged kRas serving as BRET acceptor after pre-stimulation with 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837or vehicle of three independent experiments (right). (E) IL-1β release of dendritic cells stimulated with 80 µM Dynasore, 30 µg/ml R837, 10 µM Dyngo-4a or in combination with 10 µM MCC-950 for 90 min; n = 3. Statistics indicate significance by student’s two-tailed t-test (**** = P < 0.0001). (F) Immunofluorescence of ASC in BMDCs treated with 80 µM Dynasore, 10 µM MCC- 950, a combination thereof or vehicle control for 90 min. (G) Velocity in [µm/min] and directionality of dendritic cells per replicate during in-vitro 3D collagen migration assay over a timespan of 3 h after treatment with 1% DMSO, 30 µg/ml R837 or 30 µg/ml R837 + 10 µM MCC-950. Statistics indicate significance by Kruskal-Wallis test (n.s. = not significant, **** = P < 0.0001).

Journal: bioRxiv

Article Title: NLRP3 activators disrupt the endocytic AP2 complex and plasma membrane signaling

doi: 10.64898/2026.02.24.707400

Figure Lengend Snippet: (A) Representative over-time DERET of SNAP- β 2 -AR internalization in HEK293 cells overexpressing SNAP- β 2 -AR subsequent to stimulation with 60 µM Dynasore, 30 µM Dyngo-4a, 60 µg/ml R837 or 1 µM Isoproterenol. Data are shown as the mean ± SD of one representative experiment mean ± SD of one representative experiment. (B) Representative over-time DERET of 100 nM isoproterenol induced SNAP- β 2 -AR internalization in HEK293 cells overexpressing SNAP- β 2 -AR subsequent to pre-stimulation with 60 µM Dynasore, 30 µM Dyngo-4a, 60 µg/ml R837 Data are shown as the mean. (C) Over-time cAMP production in response to norepinephrine treatment in indicated concentrations (NE). Cells were treated with DMSO or R837 (60 µg/ml) for 30 min before the experiment. (D) Maximal isoproterenol-induced recruitment of nLuc-tagged β-arrestin 2 to wt - β 2 -AR in HEK293 cells and individual over-time traces measured as BRET between nLuc- β arrestin 2 and a plasma-membrane mVenus-tagged kRas serving as BRET acceptor after pre-stimulation with 60 µM Dynasore, 30 µM Dyngo-4a or 60 µg/ml R837or vehicle of three independent experiments (right). (E) IL-1β release of dendritic cells stimulated with 80 µM Dynasore, 30 µg/ml R837, 10 µM Dyngo-4a or in combination with 10 µM MCC-950 for 90 min; n = 3. Statistics indicate significance by student’s two-tailed t-test (**** = P < 0.0001). (F) Immunofluorescence of ASC in BMDCs treated with 80 µM Dynasore, 10 µM MCC- 950, a combination thereof or vehicle control for 90 min. (G) Velocity in [µm/min] and directionality of dendritic cells per replicate during in-vitro 3D collagen migration assay over a timespan of 3 h after treatment with 1% DMSO, 30 µg/ml R837 or 30 µg/ml R837 + 10 µM MCC-950. Statistics indicate significance by Kruskal-Wallis test (n.s. = not significant, **** = P < 0.0001).

Article Snippet: For spatial proteomics experiments, per replicate, approximately 100×10 6 Casp1/11 -/- or Asc -/- SILAC-heavy or -light labelled iBMDMs were primed with 1 μg/ml LPS-EB or LPS-EB Ultrapure from E. coli 0111:B4 (InvivoGen, #tlrl-eblps or #tlrl-3pelps) in CM for 4 h at 37°C, 5% CO 2 , followed by stimulation in serum free conditions with either 10 μM Nigericin (NI; Thermo Fisher Scientific, #N1495), 60 μg/ml R837/Imiquimod (InvivoGen, #tlrl-imqs-1), 10 μM monensin (Merck, #M5273), Mdivi-1 (Selleckchem, #S7162), K + -free Hank’s balanced salt solution (HBSS), 160 μM Dynasore (DS; Selleckchem, #S8047), 80 μM Dyngo-4a (DN; Selleckchem, #S7163), or serum-free DMEM as control.

Techniques: Clinical Proteomics, Membrane, Two Tailed Test, Immunofluorescence, Control, In Vitro, Migration

a Design of biodegradable alkyne lipids and layout of the combination strategy. b Cryo-EM image and schematic illustration of mRNA loaded LNPs. c – e I.v. injection of hEPO mRNA loaded LNPs containing two different ionizable lipids (0.75 mg/kg of hEPO mRNA). c cKK-E12 and alkyne lipid combinations were evaluated at two molar ratios (left: 5:5, right: 7:3); combination of C12-200 and MC3 with alkyne lipids were evaluated at molar ratio 7:3, respectively. Formulation includes a composition of ionizable lipid:DOPE:cholesterol:C14-PEG2000 at the molar ratio of 35:16.0:46.5:2.5. Six hours after injection, hEPO protein in the serum was detected and quantified using hEPO ELISA. Red stars highlight the top-performing synergistic LNPs ( n = 4/group). f , g IVIS images and quantification of luciferase expression. mRNA encoding firefly luciferase mRNA (Fluc mRNA) was formulated with LNPs composed of various molar ratios of cKK-E12 and A6. A molar ratio of cKK-E12:A6 at 7:3 (Syn-3) demonstrated the most robust enhancement in Fluc protein expression in the liver ( n = 4 in cKK-E12, 9:1, 8:2, 6:4, n = 5 in 7:3 group, n = 3 in 4:6 and A6 groups, representative images were shown in f ). h The optimal ratio of cKK-E12:A6 in the LNP formulation was also evaluated using hEPO mRNA. The optimal ratio was also found to be 7:3. i , j Dose-dependent and time-dependent protein expression using Syn-3 (cKK-E12:A6 is 7:3) LNPs was compared with cKK-E12 LNPs, and demonstrated superior gene expression in vivo. Data are presented as mean ± SD. *** P < 0.001, **** P < 0.0001, Student’s T-test comparing to cKK-E12 group.

Journal: Nature Communications

Article Title: Synergistic lipid compositions for albumin receptor mediated delivery of mRNA to the liver

doi: 10.1038/s41467-020-16248-y

Figure Lengend Snippet: a Design of biodegradable alkyne lipids and layout of the combination strategy. b Cryo-EM image and schematic illustration of mRNA loaded LNPs. c – e I.v. injection of hEPO mRNA loaded LNPs containing two different ionizable lipids (0.75 mg/kg of hEPO mRNA). c cKK-E12 and alkyne lipid combinations were evaluated at two molar ratios (left: 5:5, right: 7:3); combination of C12-200 and MC3 with alkyne lipids were evaluated at molar ratio 7:3, respectively. Formulation includes a composition of ionizable lipid:DOPE:cholesterol:C14-PEG2000 at the molar ratio of 35:16.0:46.5:2.5. Six hours after injection, hEPO protein in the serum was detected and quantified using hEPO ELISA. Red stars highlight the top-performing synergistic LNPs ( n = 4/group). f , g IVIS images and quantification of luciferase expression. mRNA encoding firefly luciferase mRNA (Fluc mRNA) was formulated with LNPs composed of various molar ratios of cKK-E12 and A6. A molar ratio of cKK-E12:A6 at 7:3 (Syn-3) demonstrated the most robust enhancement in Fluc protein expression in the liver ( n = 4 in cKK-E12, 9:1, 8:2, 6:4, n = 5 in 7:3 group, n = 3 in 4:6 and A6 groups, representative images were shown in f ). h The optimal ratio of cKK-E12:A6 in the LNP formulation was also evaluated using hEPO mRNA. The optimal ratio was also found to be 7:3. i , j Dose-dependent and time-dependent protein expression using Syn-3 (cKK-E12:A6 is 7:3) LNPs was compared with cKK-E12 LNPs, and demonstrated superior gene expression in vivo. Data are presented as mean ± SD. *** P < 0.001, **** P < 0.0001, Student’s T-test comparing to cKK-E12 group.

Article Snippet: The tubes were then centrifuged at 2000 × g for 7 min and the sera samples aliquoted and stored at −80 °C until analysis. hEPO concentrations were determined using a hEPO ELISA assay (R&D Technologies, Cambridge, MA) according to the manufacturer’s instructions.

Techniques: Cryo-EM Sample Prep, Injection, Formulation, Enzyme-linked Immunosorbent Assay, Luciferase, Expressing, Gene Expression, In Vivo

Characterization of LNP formulations.

Journal: Nature Communications

Article Title: Synergistic lipid compositions for albumin receptor mediated delivery of mRNA to the liver

doi: 10.1038/s41467-020-16248-y

Figure Lengend Snippet: Characterization of LNP formulations.

Article Snippet: The tubes were then centrifuged at 2000 × g for 7 min and the sera samples aliquoted and stored at −80 °C until analysis. hEPO concentrations were determined using a hEPO ELISA assay (R&D Technologies, Cambridge, MA) according to the manufacturer’s instructions.

Techniques:

a Schematic of fusion between A6 (blue) or cKK-E12 (red) vesicles and endosomal vesicles by MD simulation. DOPE and DOPC are in green, LBPA is in purple, cholesterol is in gray. b Estimated vesicle merging states between A6 or cKK-E12 and endosomal vesicles. Merging state is defined as the ratio between the neck area and the largest intersection area of the endosomal vesicle (Error bars: variation of the neck area). c Percentile of A6 or cKK-E12 lipid mixed in endosomal vesicles during fusion simulation. d Schematic of lipid restructuring movements in LNPs during fusion. e MD calculations of lipid tail protrusion in cKK-E12 and A6 membranes ( n = 1000). Student’s T-test. Panel on the right: a snapshot of A6 lipid protruding out the membrane with one tail. f Lateral diffusion coefficient of A6 and cKK-E12 lipid in singular membranes calculated from the mean square displacement using linear regression ( n = 5000) (Error bars: errors between individual lipids). Student’s T-test. Penal on the right: trajectory of A6 or cKK-E12 lipid within the singular membrane over 40 ns simulation. g Free energy profile of A6 and cKK-E12 lipid sprouting and flip-flop action. h , i hemolysis analysis of variable LNPs in acidic and neutral pH conditions ( n = 4), Student’s T-test. j Fluorescence resonance energy transfer (FRET) based membrane fusion assay. Rhodamine-PE and NBD-PE dual labeled endosomal vesicles (donor vesicles) were mixed with non-fluorescent labeled cKK-E12, A6, or Syn-3 LNPs. NBD fluorescence was monitored at 540 nm with excitation at 465 nm upon mixing. Mixing of un-labeled vesicles were subtracted as blank. k Time-lapse images of released free mRNA in primary hepatocytes treated with Cy5-mRNA LNPs in 10% serum. Hepatocytes were highlighted in yellow dotted circles. Yellow arrows indicate released free fluorescent mRNA observed within cytoplasm. Quantifications presented on right were based on the fluorescence intensity around the straight dotted yellow lines across hepatocytes. Blue rectangle highlights the fluorescence distributed near cell nuclei. l Hepatocytes were incubated with Cy5-mRNA-encapsulated Rhob-PE-labeled LNPs for 1 h in 10% serum. Lyso-endosome system was stained with LysoTracker green. The cytoplasmic distribution of LNPs and mRNA were visualized using confocal microscope. m , n Subcellular fractionation of hEPO mRNA from cytoplasm or membrane containing vehicles. m Time-lapse release of free hEPO mRNA into cytoplasm ( n = 8). n At 1.5 h after incubation, the distribution of hEPO mRNA in the cytoplasmic compartment and membrane associated compartment was quantified by rt-PCR ( n = 4), Student’s T-test. The subcellular isolation was confirmed by membrane associated marker Lamp-1 staining. All data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: Nature Communications

Article Title: Synergistic lipid compositions for albumin receptor mediated delivery of mRNA to the liver

doi: 10.1038/s41467-020-16248-y

Figure Lengend Snippet: a Schematic of fusion between A6 (blue) or cKK-E12 (red) vesicles and endosomal vesicles by MD simulation. DOPE and DOPC are in green, LBPA is in purple, cholesterol is in gray. b Estimated vesicle merging states between A6 or cKK-E12 and endosomal vesicles. Merging state is defined as the ratio between the neck area and the largest intersection area of the endosomal vesicle (Error bars: variation of the neck area). c Percentile of A6 or cKK-E12 lipid mixed in endosomal vesicles during fusion simulation. d Schematic of lipid restructuring movements in LNPs during fusion. e MD calculations of lipid tail protrusion in cKK-E12 and A6 membranes ( n = 1000). Student’s T-test. Panel on the right: a snapshot of A6 lipid protruding out the membrane with one tail. f Lateral diffusion coefficient of A6 and cKK-E12 lipid in singular membranes calculated from the mean square displacement using linear regression ( n = 5000) (Error bars: errors between individual lipids). Student’s T-test. Penal on the right: trajectory of A6 or cKK-E12 lipid within the singular membrane over 40 ns simulation. g Free energy profile of A6 and cKK-E12 lipid sprouting and flip-flop action. h , i hemolysis analysis of variable LNPs in acidic and neutral pH conditions ( n = 4), Student’s T-test. j Fluorescence resonance energy transfer (FRET) based membrane fusion assay. Rhodamine-PE and NBD-PE dual labeled endosomal vesicles (donor vesicles) were mixed with non-fluorescent labeled cKK-E12, A6, or Syn-3 LNPs. NBD fluorescence was monitored at 540 nm with excitation at 465 nm upon mixing. Mixing of un-labeled vesicles were subtracted as blank. k Time-lapse images of released free mRNA in primary hepatocytes treated with Cy5-mRNA LNPs in 10% serum. Hepatocytes were highlighted in yellow dotted circles. Yellow arrows indicate released free fluorescent mRNA observed within cytoplasm. Quantifications presented on right were based on the fluorescence intensity around the straight dotted yellow lines across hepatocytes. Blue rectangle highlights the fluorescence distributed near cell nuclei. l Hepatocytes were incubated with Cy5-mRNA-encapsulated Rhob-PE-labeled LNPs for 1 h in 10% serum. Lyso-endosome system was stained with LysoTracker green. The cytoplasmic distribution of LNPs and mRNA were visualized using confocal microscope. m , n Subcellular fractionation of hEPO mRNA from cytoplasm or membrane containing vehicles. m Time-lapse release of free hEPO mRNA into cytoplasm ( n = 8). n At 1.5 h after incubation, the distribution of hEPO mRNA in the cytoplasmic compartment and membrane associated compartment was quantified by rt-PCR ( n = 4), Student’s T-test. The subcellular isolation was confirmed by membrane associated marker Lamp-1 staining. All data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: The tubes were then centrifuged at 2000 × g for 7 min and the sera samples aliquoted and stored at −80 °C until analysis. hEPO concentrations were determined using a hEPO ELISA assay (R&D Technologies, Cambridge, MA) according to the manufacturer’s instructions.

Techniques: Membrane, Diffusion-based Assay, Fluorescence, Förster Resonance Energy Transfer, Single Vesicle Fusion Assay, Labeling, Incubation, Staining, Microscopy, Fractionation, Reverse Transcription Polymerase Chain Reaction, Isolation, Marker

a Dose-dependent blood chemistry assay demonstrated decreased toxicity of Syn-3 LNPs as compared with cKK-E12 LNPs with relatively low values of AST, ALT, BUN, and total bilirubin ( n = 4/group), Student’s T-test comparing to blank. b The multi-plex cytokine assay of blank LNPs (equivalent to 1.5 mg/kg mRNA LNPs) after single dose ( n = 4/group), Student’s T-test comparing to blank. c mRNA expression kinetics after multiple dosing of mRNA containing LNPs. Protein expression ratio of Syn-3 LNPs were compared with mono cKK-E12 LNPs at different time points ( n = 4). d Student’s T-test comparing to 1 Dose 6 h. e treatment of renal anemia by different forms of hEPO containing LNPs ( n = 6–8). f , g Morphology and structure of kidney after treatments. h HGB levels were also compared in different groups ( n = 6). Data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: Nature Communications

Article Title: Synergistic lipid compositions for albumin receptor mediated delivery of mRNA to the liver

doi: 10.1038/s41467-020-16248-y

Figure Lengend Snippet: a Dose-dependent blood chemistry assay demonstrated decreased toxicity of Syn-3 LNPs as compared with cKK-E12 LNPs with relatively low values of AST, ALT, BUN, and total bilirubin ( n = 4/group), Student’s T-test comparing to blank. b The multi-plex cytokine assay of blank LNPs (equivalent to 1.5 mg/kg mRNA LNPs) after single dose ( n = 4/group), Student’s T-test comparing to blank. c mRNA expression kinetics after multiple dosing of mRNA containing LNPs. Protein expression ratio of Syn-3 LNPs were compared with mono cKK-E12 LNPs at different time points ( n = 4). d Student’s T-test comparing to 1 Dose 6 h. e treatment of renal anemia by different forms of hEPO containing LNPs ( n = 6–8). f , g Morphology and structure of kidney after treatments. h HGB levels were also compared in different groups ( n = 6). Data are presented as mean ± SD. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: The tubes were then centrifuged at 2000 × g for 7 min and the sera samples aliquoted and stored at −80 °C until analysis. hEPO concentrations were determined using a hEPO ELISA assay (R&D Technologies, Cambridge, MA) according to the manufacturer’s instructions.

Techniques: Cytokine Assay, Expressing

Figure 6 Effect of temperature on the degree of fusion between fluid liposomes and two gram-negative strains, Escherichia coli K12 and Pseudomonas aeruginosa ATCC 25619, after 30 minutes at 37°C. Notes: One point nine milliliters of bacteria grown to an OD660 nm of 0.6 in Mueller Hinton broth was then mixed with labeled liposomes to a final concentration of 10 Å µg/mL and supplemented with 5 mM calcium. Fusion was monitored by rhodamine fluorescence decrease at 590 nm after 30 minutes resulting from resonance energy transfer efficiency decrease at three different temperatures. Data are shown as mean ± standard deviation (n=3). *Significance achieved for P,0.05. ATCC® 25619™ (American Type Culture Collection, Rockville, MD, USA). Abbreviation: OD, optical density.

Journal: International Journal of Nanomedicine

Article Title: Fusion between fluid liposomes and intact bacteria: study of driving parameters and in vitro bactericidal efficacy

doi: 10.2147/ijn.s55807

Figure Lengend Snippet: Figure 6 Effect of temperature on the degree of fusion between fluid liposomes and two gram-negative strains, Escherichia coli K12 and Pseudomonas aeruginosa ATCC 25619, after 30 minutes at 37°C. Notes: One point nine milliliters of bacteria grown to an OD660 nm of 0.6 in Mueller Hinton broth was then mixed with labeled liposomes to a final concentration of 10 Å µg/mL and supplemented with 5 mM calcium. Fusion was monitored by rhodamine fluorescence decrease at 590 nm after 30 minutes resulting from resonance energy transfer efficiency decrease at three different temperatures. Data are shown as mean ± standard deviation (n=3). *Significance achieved for P,0.05. ATCC® 25619™ (American Type Culture Collection, Rockville, MD, USA). Abbreviation: OD, optical density.

Article Snippet: When DPPC/DMPG (9:1 molar ratio) vesicles where mixed with bacteria in the presence of calcium (5 mM), a significant decrease in Rh fluorescence intensity (590 nm) and an increase in NBD signal (520 nm) was observed 0 Controls Escherichia coli K12 Pseudomonas aeruginoa 25619 10 20 30 40 % f lu id li p o so m es f u si o n w it h b ac te ri a 50 60 70 80 * * 4 ̊C 22 ̊C 37 ̊C Figure 6 Effect of temperature on the degree of fusion between fluid liposomes and two gram-negative strains, Escherichia coli K12 and Pseudomonas aeruginosa aTcc 25619, after 30 minutes at 37°c.

Techniques: Liposomes, Bacteria, Labeling, Concentration Assay, Fluorescence, Förster Resonance Energy Transfer, Standard Deviation

Figure 7 Sterilizing effects of bacteria exposed to free tobramycin and liposome encapsulated tobramycin. Notes: Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Burkholderia cepacia, Escherichia coli, and Staphylococcus aureus cultures received, respectively, 30, 1, 3, 0.5, and 1.50 mg/L of free tobramycin or liposomal encapsulated tobramycin. Results are expressed as the arithmetic mean of the three samples ± standard error of the mean. Abbreviations: CFU, colony forming units; PBS, phosphate buffered solution.

Journal: International Journal of Nanomedicine

Article Title: Fusion between fluid liposomes and intact bacteria: study of driving parameters and in vitro bactericidal efficacy

doi: 10.2147/ijn.s55807

Figure Lengend Snippet: Figure 7 Sterilizing effects of bacteria exposed to free tobramycin and liposome encapsulated tobramycin. Notes: Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Burkholderia cepacia, Escherichia coli, and Staphylococcus aureus cultures received, respectively, 30, 1, 3, 0.5, and 1.50 mg/L of free tobramycin or liposomal encapsulated tobramycin. Results are expressed as the arithmetic mean of the three samples ± standard error of the mean. Abbreviations: CFU, colony forming units; PBS, phosphate buffered solution.

Article Snippet: When DPPC/DMPG (9:1 molar ratio) vesicles where mixed with bacteria in the presence of calcium (5 mM), a significant decrease in Rh fluorescence intensity (590 nm) and an increase in NBD signal (520 nm) was observed 0 Controls Escherichia coli K12 Pseudomonas aeruginoa 25619 10 20 30 40 % f lu id li p o so m es f u si o n w it h b ac te ri a 50 60 70 80 * * 4 ̊C 22 ̊C 37 ̊C Figure 6 Effect of temperature on the degree of fusion between fluid liposomes and two gram-negative strains, Escherichia coli K12 and Pseudomonas aeruginosa aTcc 25619, after 30 minutes at 37°c.

Techniques: Bacteria

(A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, EGFR, ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.

Journal: PLoS Biology

Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

doi: 10.1371/journal.pbio.2006660

Figure Lengend Snippet: (A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, EGFR, ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.

Article Snippet: The coverslips were treated with anti-phospho EGFR and Alexa 647–labeled secondary antibodies for 30 min. After washing, fluorescence images were obtained to assess the EGFR phosphorylation levels in media supplemented with 5 mM protocatechuic acid (PCA, sc-205818, Santa Cruz), 0.5 U/mL protocatechuate-3,4-dioxygenase (PCD, P8279, Sigma-Aldrich), and 1 mM β-mercaptoethylamine (MEA, 30070, Sigma-Aldrich).

Techniques: Ii Assay, Labeling, Produced, Comparison, Membrane, Expressing, Biomarker Discovery, Clinical Proteomics, Fluorescence, Förster Resonance Energy Transfer, Variant Assay, Single-particle Tracking, Microscopy

(A) Schematic representation of the K D measurement of EGFR homodimerization using Co-II. EGFR-mEos3.2 becomes co-immobilized only when interacting with the surface-immobilized SNAP-EGFR by an anti-SNAP antibody; otherwise, it remains in a mobile state. (B) Trajectory map of CF660R-labeled SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment in the same single COS7 cell growing with 10% FBS. A total of 200 trajectories are shown in each trajectory map. Scale bar, 3 μm. (C) Diffusion-coefficient distribution of SNAP-EGFR and EGFR-mEos3.2 before (black line) and after anti-SNAP antibody treatment (red line). The immobilization criteria are presented as a blue dashed line. (D) The immobilized fractions of SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment. (E) Fluorescence images of total expression and single-molecule–level expression of SNAP-EGFR. Scale bars, 5 μm and 2 μm, respectively. A fluorescence intensity profile of single SNAP-EGFR shows a single bleaching step. (F) K D analysis using a binding curve of prey EGFR to bait EGFR (y-axis) with respect to the density of the antibody-induced immobilized bait EGFR (x-axis). The bound/unbound ratio of the prey with respect to the density is shown (left inset) with a linear fit (red solid line) and a 95% confidence interval (red dashed lines). Scatchard plot for EGFR pre-homodimerization is shown (right inset). The K D was determined in DMEM supplemented with 10% FBS at 37 °C. Each dot indicates data obtained from individual cells. (G) K D of EGFR pre-homodimerization measured in various cell lines. The error bars represent the SEM at the single-cell level ( n > 4). (H) A spatial K D map of EGFR pre-homodimerization and the log-normal distribution of the K D values obtained from different regions of plasma membrane in a single living cell. Scale bar, 5 μm. (I) The K D profiles obtained from the cross sections corresponding to the red dashed lines in panel H. (J) The box plots displaying the distributions of K D values obtained from periphery or center regions of each single cell. n = 10. * p < 0.05 (Student t test). A.U., arbitrary unit; DMEM, Dulbecco's Modified Eagle Medium; EGFR, epidermal growth factor receptor; FBS, fetal bovine serum; mEos3.2, monomeric Eos fluorescent protein variant 3.2; SNAP, SNAP-tag.

Journal: PLoS Biology

Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

doi: 10.1371/journal.pbio.2006660

Figure Lengend Snippet: (A) Schematic representation of the K D measurement of EGFR homodimerization using Co-II. EGFR-mEos3.2 becomes co-immobilized only when interacting with the surface-immobilized SNAP-EGFR by an anti-SNAP antibody; otherwise, it remains in a mobile state. (B) Trajectory map of CF660R-labeled SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment in the same single COS7 cell growing with 10% FBS. A total of 200 trajectories are shown in each trajectory map. Scale bar, 3 μm. (C) Diffusion-coefficient distribution of SNAP-EGFR and EGFR-mEos3.2 before (black line) and after anti-SNAP antibody treatment (red line). The immobilization criteria are presented as a blue dashed line. (D) The immobilized fractions of SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment. (E) Fluorescence images of total expression and single-molecule–level expression of SNAP-EGFR. Scale bars, 5 μm and 2 μm, respectively. A fluorescence intensity profile of single SNAP-EGFR shows a single bleaching step. (F) K D analysis using a binding curve of prey EGFR to bait EGFR (y-axis) with respect to the density of the antibody-induced immobilized bait EGFR (x-axis). The bound/unbound ratio of the prey with respect to the density is shown (left inset) with a linear fit (red solid line) and a 95% confidence interval (red dashed lines). Scatchard plot for EGFR pre-homodimerization is shown (right inset). The K D was determined in DMEM supplemented with 10% FBS at 37 °C. Each dot indicates data obtained from individual cells. (G) K D of EGFR pre-homodimerization measured in various cell lines. The error bars represent the SEM at the single-cell level ( n > 4). (H) A spatial K D map of EGFR pre-homodimerization and the log-normal distribution of the K D values obtained from different regions of plasma membrane in a single living cell. Scale bar, 5 μm. (I) The K D profiles obtained from the cross sections corresponding to the red dashed lines in panel H. (J) The box plots displaying the distributions of K D values obtained from periphery or center regions of each single cell. n = 10. * p < 0.05 (Student t test). A.U., arbitrary unit; DMEM, Dulbecco's Modified Eagle Medium; EGFR, epidermal growth factor receptor; FBS, fetal bovine serum; mEos3.2, monomeric Eos fluorescent protein variant 3.2; SNAP, SNAP-tag.

Article Snippet: The coverslips were treated with anti-phospho EGFR and Alexa 647–labeled secondary antibodies for 30 min. After washing, fluorescence images were obtained to assess the EGFR phosphorylation levels in media supplemented with 5 mM protocatechuic acid (PCA, sc-205818, Santa Cruz), 0.5 U/mL protocatechuate-3,4-dioxygenase (PCD, P8279, Sigma-Aldrich), and 1 mM β-mercaptoethylamine (MEA, 30070, Sigma-Aldrich).

Techniques: Labeling, Diffusion-based Assay, Fluorescence, Expressing, Binding Assay, Clinical Proteomics, Membrane, Modification, Variant Assay

(A–B) K D values of EGFR homodimerization measured with and without EGF under the treatment of nonnatural ligands, including a Fab fragment of cetuximab and two types of tyrosine kinase inhibitors, erlotinib and lapatinib, in serum-starved COS7 cells. (C) K D values of homodimerization for EGFR WT (the same data for NT in panel A), EGFRvIII, and EGFR L858R. The error bars represent the SEM at the single-cell level ( n > 10). All the measurements were performed in a serum-free DMEM at 37 °C. * p < 0.05 (Student t test). (D) A scale mapping K D values of EGFR homodimerization under various molecular perturbations. The yellow and green dots indicate the perturbations to EGFR ECD and ICD, respectively, and a black dot indicates no perturbation. Each perturbation site is displayed in the illustration, representing the reaction of EGFR pre-homodimerization with log2 fold change values compared with the K D without perturbation. DMEM, Dulbecco's Modified Eagle Medium; ECD, extracellular domain; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; Fab, fragment antigen-binding; ICD, intracellular domain; NT, not treated; WT, wild type.

Journal: PLoS Biology

Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

doi: 10.1371/journal.pbio.2006660

Figure Lengend Snippet: (A–B) K D values of EGFR homodimerization measured with and without EGF under the treatment of nonnatural ligands, including a Fab fragment of cetuximab and two types of tyrosine kinase inhibitors, erlotinib and lapatinib, in serum-starved COS7 cells. (C) K D values of homodimerization for EGFR WT (the same data for NT in panel A), EGFRvIII, and EGFR L858R. The error bars represent the SEM at the single-cell level ( n > 10). All the measurements were performed in a serum-free DMEM at 37 °C. * p < 0.05 (Student t test). (D) A scale mapping K D values of EGFR homodimerization under various molecular perturbations. The yellow and green dots indicate the perturbations to EGFR ECD and ICD, respectively, and a black dot indicates no perturbation. Each perturbation site is displayed in the illustration, representing the reaction of EGFR pre-homodimerization with log2 fold change values compared with the K D without perturbation. DMEM, Dulbecco's Modified Eagle Medium; ECD, extracellular domain; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; Fab, fragment antigen-binding; ICD, intracellular domain; NT, not treated; WT, wild type.

Article Snippet: The coverslips were treated with anti-phospho EGFR and Alexa 647–labeled secondary antibodies for 30 min. After washing, fluorescence images were obtained to assess the EGFR phosphorylation levels in media supplemented with 5 mM protocatechuic acid (PCA, sc-205818, Santa Cruz), 0.5 U/mL protocatechuate-3,4-dioxygenase (PCD, P8279, Sigma-Aldrich), and 1 mM β-mercaptoethylamine (MEA, 30070, Sigma-Aldrich).

Techniques: Modification, Binding Assay

K D values of EGFR and β2-AR homodimerizations were determined by Co-II under the existence of their ligands (EGF and ISO, respectively) and the sequestration of cholesterol in a plasma membrane. The scale mapping K D values for their homodimerizations are displayed for direct comparisons. β2-AR, beta-2 adrenergic receptor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; ISO, isoproterenol; NT, not treated; SNAP, SNAP-tag.

Journal: PLoS Biology

Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

doi: 10.1371/journal.pbio.2006660

Figure Lengend Snippet: K D values of EGFR and β2-AR homodimerizations were determined by Co-II under the existence of their ligands (EGF and ISO, respectively) and the sequestration of cholesterol in a plasma membrane. The scale mapping K D values for their homodimerizations are displayed for direct comparisons. β2-AR, beta-2 adrenergic receptor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; ISO, isoproterenol; NT, not treated; SNAP, SNAP-tag.

Article Snippet: The coverslips were treated with anti-phospho EGFR and Alexa 647–labeled secondary antibodies for 30 min. After washing, fluorescence images were obtained to assess the EGFR phosphorylation levels in media supplemented with 5 mM protocatechuic acid (PCA, sc-205818, Santa Cruz), 0.5 U/mL protocatechuate-3,4-dioxygenase (PCD, P8279, Sigma-Aldrich), and 1 mM β-mercaptoethylamine (MEA, 30070, Sigma-Aldrich).

Techniques: Clinical Proteomics, Membrane

(A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, EGFR, ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.

Journal: PLoS Biology

Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

doi: 10.1371/journal.pbio.2006660

Figure Lengend Snippet: (A) Schematic of the Co-II assay. The interaction between a fluorescently labeled prey protein and a bait protein is specifically probed by the co-immobilized prey produced after antibody-induced immobilization of the bait protein, which is visualized using sptPALM in single living cells. (B) Comparison between a diffusivity-based method (Co-II) and a proximity-based method (e.g., FRET). In the crowded membrane of living cells, Co-II specifically detects genuine interactions between membrane proteins, while the proximity-based methods are vulnerable to producing false positive signals because a prey and a bait are located nearby. Co-II captures membrane protein interactions independent of tag orientation, while the proximity-based methods require a careful design for donor–acceptor orientation. (C) The bait-specific immobilization using a surface-coated antibody in living cells. The immobilized fractions of PMT, EGFR, ErbB2, ErbB3, InsR, and β2-AR in multiple cells before (NT) and after anti-EGFR antibody treatment. Examined membrane proteins were expressed at a level at least 10 times higher than the expression level of EGFR to avoid the specific co-immobilization resulting from the genuine interaction with EGFR. Each dot represents single-cell data, and the red solid lines indicate the average of the immobilized fraction obtained from multiple cells ( n > 10). (D–E) Illustration and trajectory maps for validation of molecule-specific immobilization in the plasma membrane of a living cell. A total of 400 trajectories are shown in each trajectory map. Scale bar, 2 μm. SNAP-EGFR was specifically and almost completely immobilized by anti-EGFR antibody treatment, whereas the immobilized fraction of β2-AR-mEos3.2 was not altered (D). Specific immobilization of β2-AR against EGFR was confirmed vice versa using SNAP-β2-AR and EGFR-mEos3.2 with anti-SNAP antibody (E). β2-AR, beta-2 adrenergic receptor; EGFR, epidermal growth factor receptor; ErbB2, erb-b2 receptor tyrosine kinase 2; ErbB3, erb-b2 receptor tyrosine kinase 3; FRET, fluorescence resonance energy transfer; InsR, insulin receptor; mEos3.2, monomeric Eos fluorescent protein variant 3.2; NT, not treated; PMT, plasma membrane targeting; SNAP, SNAP-tag; sptPALM, single-particle tracking photoactivated localization microscopy.

Article Snippet: Primer 1: 5′-CGCAAATGGGCGGTAGGCGTG Primer 2: 5′-CCGCGGTTGGCGCGCCAGCCCGACTCGCCGGGCAGAG Primer 3: 5′-GGCGCGCCAACCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 4: 5′-AGCTTTGTTTAAACTTATGCTCCAATAAATTCACTGCT Primer 5: 5′-GGCGCGCCACATCATCACCATCACCATATGAGTGCGATTAAGCCAGAC Primer 6: 5′-TCCCCGCGGCCCTCCACTCCCACTTCGTCTGGCATTGTCAGGCAA Primer 7: 5′-GGCGCGCCACATCATCACCATCACCATATGGACAAAGACTGCGAAATG Primer 8: 5′-TCCCCGCGGCCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG Primer 9: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGGTAAT Primer 10: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 11: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 12: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 13: 5′-CGGGATCCATGGCCACCGGGGGCCGGCGG Primer 14: 5′-GCTCTAGAACTCCCGGAAGGATTGGACCGAGGCAA The antibodies and reagents were obtained from the following vendors: the mAb 199.12 (AHR5072) and Alexa Fluor 647–conjugated anti-mouse antibody (A21235) were obtained from Invitrogen; both mAb 528 (sc-120) and mAb R-1 (sc-101) were obtained from Santa Cruz; the SNAP tag antibody (CAB4255), rabbit anti-mouse IgG (31194), biotin-conjugated EGFR antibody (MA5-12872), and anti-6x His tag antibody (MA1-21315) were obtained from Thermo Scientific; the anti-mEos3.2 antibody (A010-mEOS) was purchased from Badrilla; the anti-phosphorylated EGFR antibody (Y1068, ab32430) was obtained from Abcam; the anti-actin antibody (691001) was obtained from MP Biomedicals; cetuximab was obtained from Merck Serono; erlotinib and lapatinib were obtained from Selleckchem; and EGF (E9644), nystatin (N6261), and isoproterenol (I5627) were purchased from Sigma-Aldrich.

Techniques: Ii Assay, Labeling, Produced, Comparison, Membrane, Expressing, Biomarker Discovery, Clinical Proteomics, Fluorescence, Förster Resonance Energy Transfer, Variant Assay, Single-particle Tracking, Microscopy

(A) Schematic representation of the K D measurement of EGFR homodimerization using Co-II. EGFR-mEos3.2 becomes co-immobilized only when interacting with the surface-immobilized SNAP-EGFR by an anti-SNAP antibody; otherwise, it remains in a mobile state. (B) Trajectory map of CF660R-labeled SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment in the same single COS7 cell growing with 10% FBS. A total of 200 trajectories are shown in each trajectory map. Scale bar, 3 μm. (C) Diffusion-coefficient distribution of SNAP-EGFR and EGFR-mEos3.2 before (black line) and after anti-SNAP antibody treatment (red line). The immobilization criteria are presented as a blue dashed line. (D) The immobilized fractions of SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment. (E) Fluorescence images of total expression and single-molecule–level expression of SNAP-EGFR. Scale bars, 5 μm and 2 μm, respectively. A fluorescence intensity profile of single SNAP-EGFR shows a single bleaching step. (F) K D analysis using a binding curve of prey EGFR to bait EGFR (y-axis) with respect to the density of the antibody-induced immobilized bait EGFR (x-axis). The bound/unbound ratio of the prey with respect to the density is shown (left inset) with a linear fit (red solid line) and a 95% confidence interval (red dashed lines). Scatchard plot for EGFR pre-homodimerization is shown (right inset). The K D was determined in DMEM supplemented with 10% FBS at 37 °C. Each dot indicates data obtained from individual cells. (G) K D of EGFR pre-homodimerization measured in various cell lines. The error bars represent the SEM at the single-cell level ( n > 4). (H) A spatial K D map of EGFR pre-homodimerization and the log-normal distribution of the K D values obtained from different regions of plasma membrane in a single living cell. Scale bar, 5 μm. (I) The K D profiles obtained from the cross sections corresponding to the red dashed lines in panel H. (J) The box plots displaying the distributions of K D values obtained from periphery or center regions of each single cell. n = 10. * p < 0.05 (Student t test). A.U., arbitrary unit; DMEM, Dulbecco's Modified Eagle Medium; EGFR, epidermal growth factor receptor; FBS, fetal bovine serum; mEos3.2, monomeric Eos fluorescent protein variant 3.2; SNAP, SNAP-tag.

Journal: PLoS Biology

Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

doi: 10.1371/journal.pbio.2006660

Figure Lengend Snippet: (A) Schematic representation of the K D measurement of EGFR homodimerization using Co-II. EGFR-mEos3.2 becomes co-immobilized only when interacting with the surface-immobilized SNAP-EGFR by an anti-SNAP antibody; otherwise, it remains in a mobile state. (B) Trajectory map of CF660R-labeled SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment in the same single COS7 cell growing with 10% FBS. A total of 200 trajectories are shown in each trajectory map. Scale bar, 3 μm. (C) Diffusion-coefficient distribution of SNAP-EGFR and EGFR-mEos3.2 before (black line) and after anti-SNAP antibody treatment (red line). The immobilization criteria are presented as a blue dashed line. (D) The immobilized fractions of SNAP-EGFR and EGFR-mEos3.2 before and after anti-SNAP antibody treatment. (E) Fluorescence images of total expression and single-molecule–level expression of SNAP-EGFR. Scale bars, 5 μm and 2 μm, respectively. A fluorescence intensity profile of single SNAP-EGFR shows a single bleaching step. (F) K D analysis using a binding curve of prey EGFR to bait EGFR (y-axis) with respect to the density of the antibody-induced immobilized bait EGFR (x-axis). The bound/unbound ratio of the prey with respect to the density is shown (left inset) with a linear fit (red solid line) and a 95% confidence interval (red dashed lines). Scatchard plot for EGFR pre-homodimerization is shown (right inset). The K D was determined in DMEM supplemented with 10% FBS at 37 °C. Each dot indicates data obtained from individual cells. (G) K D of EGFR pre-homodimerization measured in various cell lines. The error bars represent the SEM at the single-cell level ( n > 4). (H) A spatial K D map of EGFR pre-homodimerization and the log-normal distribution of the K D values obtained from different regions of plasma membrane in a single living cell. Scale bar, 5 μm. (I) The K D profiles obtained from the cross sections corresponding to the red dashed lines in panel H. (J) The box plots displaying the distributions of K D values obtained from periphery or center regions of each single cell. n = 10. * p < 0.05 (Student t test). A.U., arbitrary unit; DMEM, Dulbecco's Modified Eagle Medium; EGFR, epidermal growth factor receptor; FBS, fetal bovine serum; mEos3.2, monomeric Eos fluorescent protein variant 3.2; SNAP, SNAP-tag.

Article Snippet: Primer 1: 5′-CGCAAATGGGCGGTAGGCGTG Primer 2: 5′-CCGCGGTTGGCGCGCCAGCCCGACTCGCCGGGCAGAG Primer 3: 5′-GGCGCGCCAACCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 4: 5′-AGCTTTGTTTAAACTTATGCTCCAATAAATTCACTGCT Primer 5: 5′-GGCGCGCCACATCATCACCATCACCATATGAGTGCGATTAAGCCAGAC Primer 6: 5′-TCCCCGCGGCCCTCCACTCCCACTTCGTCTGGCATTGTCAGGCAA Primer 7: 5′-GGCGCGCCACATCATCACCATCACCATATGGACAAAGACTGCGAAATG Primer 8: 5′-TCCCCGCGGCCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG Primer 9: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGGTAAT Primer 10: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 11: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 12: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 13: 5′-CGGGATCCATGGCCACCGGGGGCCGGCGG Primer 14: 5′-GCTCTAGAACTCCCGGAAGGATTGGACCGAGGCAA The antibodies and reagents were obtained from the following vendors: the mAb 199.12 (AHR5072) and Alexa Fluor 647–conjugated anti-mouse antibody (A21235) were obtained from Invitrogen; both mAb 528 (sc-120) and mAb R-1 (sc-101) were obtained from Santa Cruz; the SNAP tag antibody (CAB4255), rabbit anti-mouse IgG (31194), biotin-conjugated EGFR antibody (MA5-12872), and anti-6x His tag antibody (MA1-21315) were obtained from Thermo Scientific; the anti-mEos3.2 antibody (A010-mEOS) was purchased from Badrilla; the anti-phosphorylated EGFR antibody (Y1068, ab32430) was obtained from Abcam; the anti-actin antibody (691001) was obtained from MP Biomedicals; cetuximab was obtained from Merck Serono; erlotinib and lapatinib were obtained from Selleckchem; and EGF (E9644), nystatin (N6261), and isoproterenol (I5627) were purchased from Sigma-Aldrich.

Techniques: Labeling, Diffusion-based Assay, Fluorescence, Expressing, Binding Assay, Clinical Proteomics, Membrane, Modification, Variant Assay

(A–B) K D values of EGFR homodimerization measured with and without EGF under the treatment of nonnatural ligands, including a Fab fragment of cetuximab and two types of tyrosine kinase inhibitors, erlotinib and lapatinib, in serum-starved COS7 cells. (C) K D values of homodimerization for EGFR WT (the same data for NT in panel A), EGFRvIII, and EGFR L858R. The error bars represent the SEM at the single-cell level ( n > 10). All the measurements were performed in a serum-free DMEM at 37 °C. * p < 0.05 (Student t test). (D) A scale mapping K D values of EGFR homodimerization under various molecular perturbations. The yellow and green dots indicate the perturbations to EGFR ECD and ICD, respectively, and a black dot indicates no perturbation. Each perturbation site is displayed in the illustration, representing the reaction of EGFR pre-homodimerization with log2 fold change values compared with the K D without perturbation. DMEM, Dulbecco's Modified Eagle Medium; ECD, extracellular domain; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; Fab, fragment antigen-binding; ICD, intracellular domain; NT, not treated; WT, wild type.

Journal: PLoS Biology

Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

doi: 10.1371/journal.pbio.2006660

Figure Lengend Snippet: (A–B) K D values of EGFR homodimerization measured with and without EGF under the treatment of nonnatural ligands, including a Fab fragment of cetuximab and two types of tyrosine kinase inhibitors, erlotinib and lapatinib, in serum-starved COS7 cells. (C) K D values of homodimerization for EGFR WT (the same data for NT in panel A), EGFRvIII, and EGFR L858R. The error bars represent the SEM at the single-cell level ( n > 10). All the measurements were performed in a serum-free DMEM at 37 °C. * p < 0.05 (Student t test). (D) A scale mapping K D values of EGFR homodimerization under various molecular perturbations. The yellow and green dots indicate the perturbations to EGFR ECD and ICD, respectively, and a black dot indicates no perturbation. Each perturbation site is displayed in the illustration, representing the reaction of EGFR pre-homodimerization with log2 fold change values compared with the K D without perturbation. DMEM, Dulbecco's Modified Eagle Medium; ECD, extracellular domain; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; Fab, fragment antigen-binding; ICD, intracellular domain; NT, not treated; WT, wild type.

Article Snippet: Primer 1: 5′-CGCAAATGGGCGGTAGGCGTG Primer 2: 5′-CCGCGGTTGGCGCGCCAGCCCGACTCGCCGGGCAGAG Primer 3: 5′-GGCGCGCCAACCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 4: 5′-AGCTTTGTTTAAACTTATGCTCCAATAAATTCACTGCT Primer 5: 5′-GGCGCGCCACATCATCACCATCACCATATGAGTGCGATTAAGCCAGAC Primer 6: 5′-TCCCCGCGGCCCTCCACTCCCACTTCGTCTGGCATTGTCAGGCAA Primer 7: 5′-GGCGCGCCACATCATCACCATCACCATATGGACAAAGACTGCGAAATG Primer 8: 5′-TCCCCGCGGCCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG Primer 9: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGGTAAT Primer 10: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 11: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 12: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 13: 5′-CGGGATCCATGGCCACCGGGGGCCGGCGG Primer 14: 5′-GCTCTAGAACTCCCGGAAGGATTGGACCGAGGCAA The antibodies and reagents were obtained from the following vendors: the mAb 199.12 (AHR5072) and Alexa Fluor 647–conjugated anti-mouse antibody (A21235) were obtained from Invitrogen; both mAb 528 (sc-120) and mAb R-1 (sc-101) were obtained from Santa Cruz; the SNAP tag antibody (CAB4255), rabbit anti-mouse IgG (31194), biotin-conjugated EGFR antibody (MA5-12872), and anti-6x His tag antibody (MA1-21315) were obtained from Thermo Scientific; the anti-mEos3.2 antibody (A010-mEOS) was purchased from Badrilla; the anti-phosphorylated EGFR antibody (Y1068, ab32430) was obtained from Abcam; the anti-actin antibody (691001) was obtained from MP Biomedicals; cetuximab was obtained from Merck Serono; erlotinib and lapatinib were obtained from Selleckchem; and EGF (E9644), nystatin (N6261), and isoproterenol (I5627) were purchased from Sigma-Aldrich.

Techniques: Modification, Binding Assay

K D values of EGFR and β2-AR homodimerizations were determined by Co-II under the existence of their ligands (EGF and ISO, respectively) and the sequestration of cholesterol in a plasma membrane. The scale mapping K D values for their homodimerizations are displayed for direct comparisons. β2-AR, beta-2 adrenergic receptor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; ISO, isoproterenol; NT, not treated; SNAP, SNAP-tag.

Journal: PLoS Biology

Article Title: Direct visualization of single-molecule membrane protein interactions in living cells

doi: 10.1371/journal.pbio.2006660

Figure Lengend Snippet: K D values of EGFR and β2-AR homodimerizations were determined by Co-II under the existence of their ligands (EGF and ISO, respectively) and the sequestration of cholesterol in a plasma membrane. The scale mapping K D values for their homodimerizations are displayed for direct comparisons. β2-AR, beta-2 adrenergic receptor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; ISO, isoproterenol; NT, not treated; SNAP, SNAP-tag.

Article Snippet: Primer 1: 5′-CGCAAATGGGCGGTAGGCGTG Primer 2: 5′-CCGCGGTTGGCGCGCCAGCCCGACTCGCCGGGCAGAG Primer 3: 5′-GGCGCGCCAACCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 4: 5′-AGCTTTGTTTAAACTTATGCTCCAATAAATTCACTGCT Primer 5: 5′-GGCGCGCCACATCATCACCATCACCATATGAGTGCGATTAAGCCAGAC Primer 6: 5′-TCCCCGCGGCCCTCCACTCCCACTTCGTCTGGCATTGTCAGGCAA Primer 7: 5′-GGCGCGCCACATCATCACCATCACCATATGGACAAAGACTGCGAAATG Primer 8: 5′-TCCCCGCGGCCCTCCACTCCCACT ACCCAGCCCAGGCTTGCCCAG Primer 9: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGGTAAT Primer 10: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 11: 5′-TCCCCGCGGCTGGAGGAAAAGAAAGTTTGC Primer 12: 5′-AGCTTTGTTTAAACTCATGCTCCAATAAATTCACT Primer 13: 5′-CGGGATCCATGGCCACCGGGGGCCGGCGG Primer 14: 5′-GCTCTAGAACTCCCGGAAGGATTGGACCGAGGCAA The antibodies and reagents were obtained from the following vendors: the mAb 199.12 (AHR5072) and Alexa Fluor 647–conjugated anti-mouse antibody (A21235) were obtained from Invitrogen; both mAb 528 (sc-120) and mAb R-1 (sc-101) were obtained from Santa Cruz; the SNAP tag antibody (CAB4255), rabbit anti-mouse IgG (31194), biotin-conjugated EGFR antibody (MA5-12872), and anti-6x His tag antibody (MA1-21315) were obtained from Thermo Scientific; the anti-mEos3.2 antibody (A010-mEOS) was purchased from Badrilla; the anti-phosphorylated EGFR antibody (Y1068, ab32430) was obtained from Abcam; the anti-actin antibody (691001) was obtained from MP Biomedicals; cetuximab was obtained from Merck Serono; erlotinib and lapatinib were obtained from Selleckchem; and EGF (E9644), nystatin (N6261), and isoproterenol (I5627) were purchased from Sigma-Aldrich.

Techniques: Clinical Proteomics, Membrane